%PDF-1.3 % 1 0 obj <>stream application/pdf whitepaper(final) 2017-05-12T09:36:02+01:00 2017-05-12T09:36:02+01:00 2017-05-03T16:21:40+01:00 Adobe Illustrator CC 2017 (Macintosh) 256 64 JPEG /9j/4AAQSkZJRgABAgEBLAEsAAD/7QAsUGhvdG9zaG9wIDMuMAA4QklNA+0AAAAAABABLAAAAAEA AQEsAAAAAQAB/+4ADkFkb2JlAGTAAAAAAf/bAIQABgQEBAUEBgUFBgkGBQYJCwgGBggLDAoKCwoK DBAMDAwMDAwQDA4PEA8ODBMTFBQTExwbGxscHx8fHx8fHx8fHwEHBwcNDA0YEBAYGhURFRofHx8f Hx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8fHx8f/8AAEQgAQAEAAwER AAIRAQMRAf/EAaIAAAAHAQEBAQEAAAAAAAAAAAQFAwIGAQAHCAkKCwEAAgIDAQEBAQEAAAAAAAAA AQACAwQFBgcICQoLEAACAQMDAgQCBgcDBAIGAnMBAgMRBAAFIRIxQVEGE2EicYEUMpGhBxWxQiPB UtHhMxZi8CRygvElQzRTkqKyY3PCNUQnk6OzNhdUZHTD0uIIJoMJChgZhJRFRqS0VtNVKBry4/PE 1OT0ZXWFlaW1xdXl9WZ2hpamtsbW5vY3R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo+Ck5SVlpeYmZ qbnJ2en5KjpKWmp6ipqqusra6voRAAICAQIDBQUEBQYECAMDbQEAAhEDBCESMUEFURNhIgZxgZEy obHwFMHR4SNCFVJicvEzJDRDghaSUyWiY7LCB3PSNeJEgxdUkwgJChgZJjZFGidkdFU38qOzwygp 0+PzhJSktMTU5PRldYWVpbXF1eX1RlZmdoaWprbG1ub2R1dnd4eXp7fH1+f3OEhYaHiImKi4yNjo +DlJWWl5iZmpucnZ6fkqOkpaanqKmqq6ytrq+v/aAAwDAQACEQMRAD8A9IzecPLUGryaRcahFb30 QqyTN6a14q5QO1ELhJEYrWtCDkuA1bHiF0mlvc21zCs9tKk8L14SxsHU0NDRlqOoyLJe7KiM7fZU EnvsPliqS2fnfyhe6hDptnrFpcahcKHgtI5VaV1aP1QyoDyIMfx1/l36ZM45AWQxEgkP5peedX8q WdvLpqWzPNHK5N2CUDLNbxJU+rAqrW4+IltuvahERaylTFrL85PMbrbevDYzPPDDO0dtHMSilAJ+ TNL6a0krxLMAB16VyMyIxJPRMLkQALJQVx+fmvW2ovEdKhurWCa5W6+rhi8UEMirHIXMnDkU5OVN OwrWuAllGNp7p35saxceYtR06a2to7a14i3fi4dyXljbcyUYVi7DbeuAmkAMn8veadT1DVIrS6W3 VJIZJaRB+Z4FOJ+JjQfGa/ry0xFW1xmTIhbrP5meX9I1OXTbuK6+sQkBiqJxNRWoLOu2EYyRbIzA Qw/N3yq0XqRx3clAWkVYlqgBAq1XpQ17HD4RRxhTb84/Ki0/dXZrvtGh6Ej/AH57Y+EV4wmGk/mT 5d1TVItMtxcLdTHiokjAAPAuwNGJHHjQ+/tvkTjIFpEgwz/nJq2a58kaVbq6RtLrECB5DxQE29wK sewy3TH1H3NGqFxA83zrD5Ou5Ikk+v2CBwCoa4APxCu+23hmZxuH4J7wu0rX9c/L3XRrempa32o2 MJeNDzngKSj05C3pNGx4IzHZtqeGVZpDgbMESJ0zXR/+cq/zK1C9sIpbPRbS2vJUQzSWt5tG0vpM 6D60BJTfZT7Zr8kqB4fVLu5We6+luwF9WaeQ/wA+/OevecvLui31npyWWsmf1XhjmSZFiR2Ub3Eq o1U+IGv6jlEMpOQx6D9Tt8+hhDSwyji4pXfdzrbb9LJfNv5t+YtK87Xvlyy0+3aG09FhdSpNIWWS GORqqjJT4pKVr0HzpZxG/J1lCvNEea/zcuNK8upq1j9RuIYCkd/O7SK3rUIkSG1k9GVl5ceL8jtW ooCwjKUzQhVuTpIYSScxkI1tXU93I+f60H+Xn5z3/mszXMw0+zs7QsJrZ2ZLyUOP3BhR5KVkPGld jWgaoOWcMxzYTjhP0E79/wCn9jHr78+/OtlqV0t1Y6bBp9pLKZiVuHZYYSSwEgkHJuK7N6Yqf2e2 St1wySM+Hbmy38kPzP8AMPnu31afWba0tPqzQSWcFqsiusNwZeHrc5JKsREDsBi32xFfzw/MZ9Xf RlttJ/SM2mpqtoBb3axqjtQRSetPA5kPHhTitHcV2RjmB+c2MhXCDR9/wv8AHvczHixkUeLi/H7P wN33P54/mJa+b7jy2+l6fLPalfWdI5qBXthdcqpPKARHIg492PENU5Yc0gL23XHpxklUb8z+z8b9 yR3f/OTXnKK4uIo7bSwYI2jaOW2vEZbpAEKvymWiGWtK0+GlaHCM0vx3NZxAGj31+Px71XRP+ckf P2oW73D6RZLHBMtrcKLe4UrJ6aszVa42AqW4sBsQK8tspy6yUD05X+Px9juNH2RDPE1IiV1Vfb5A dfs32ezflz5xm81aVeXkoQNa3QtSqRPCQRbQSvyR3koecrcaN9nj3rmXhyGcbdVrNMcGTgJBI7v7 AoSfmZDGk3/OteYGlhcp6I09uT8S3xRksEYFULAhvAfaIXMnw/MOD4nkVQ/mNE0kaW3l7W7kPIiG SOyPpBXUtz9RmVGVQu/Enfbrj4fmE8fkXS/mKqzy28XlvW7ieH0zJHHaxghJQSr1eVBSqMtK126U ocfD8wpn5FMNJ832+pXkdsum6jbrMheG6ntmFu1Oq+qhdVNP56A9iTtkTCkiSbHTtPN216bWE3jo sb3Ppr6pRCSql6ciFLGgwWU0rRxxxoEjUIg6KoAA79BgSo6hp2n6lZyWWo2sN7Zy09W2uI1libiw ZeSOCpowBG3XCCRuFIQlv5X8tW16t9baTZQ3qSSzJdR28SSiWccZZA4UMGkXZzWp74TORFWjhDyn /nI3UGtp/LEKrLIbhrselE3plihtyvx9BR+LLXuK9sgRY50xk8eu7jzRcehLc288qwLxuBNcKyzR gkyczyH2q79tqmuQ8SH84fan1dxS+xn1TVbqWe2t/R0+SkmoSIYLaJVEgryd2hjLtVdyQSflhyY+ GVHmiB4hYZIb+90e++twyVt9RtWJ1Esjj6yrpJLzYtOrxQyTfFInetDscjwSkfd9zliMYnc2DHp3 sr/IbU9fv/Pcd7qVzcHT76xvX0tHuDNFJ6VygkURk8o/TDqoqoHw7ZYLceh3PVNf4fpe5JlmUChk CR1HFQpJB9TegI7YbVAx3GmpKUmvLj0+H94sQXlUlVozOw6xt0pTvscNqiRPoDxOxurscioWojLc SaBVqTSlOpxtUfpq6Xd6lG1pc3bTKebN+7RSORDV+yxrvXj0wWrGP+ciPX/wxoP1cI0/6dtfSWSo Qt6E9A1N6HL9PzPuaNRyHveOTWv5gO5aH6nFGeCJHTkaED4qunLxrXf8MyLi0kZPJhfnvT9eflZ3 8sE91IgMdvbH4VPqo7VRQvEv198GQXA0xiTGY4kw8i3mi6PHaw6p5JNzdxqpnugGaStOPMV+PerH rStPAU0OfSZpS4o5ABffs7vFrMIjwmBvvr9b0bybfflofzM0F9H8uT6fqctw/p3dxJcO4LxuGakr kHlUivHvjg0+p8TiJHhjnuD0/Xuzy6vCcfBdyPL011ZJ+bf5a32reY7u7a7FrZ6w0ScoobqSQxww okqO8EbpHzCU+PqNsypcdmo38R+twwRW5YQPyfubTybe6Fpd3GZtQZZ0nu4b+MrxaMk+n9VYoePE GgrvQmhpjA5BOzH7Y/rZAwMCL3934pN/y78i3mi3E0OtT+rqFWaYW1tqn1ZoDGI1iPqW0cRor/CY +JSgArQ5fPLkJ+k8Pd6f+KYw8MCv4u/f8fekOpfk95p1nU7+W819l0W/vBdSW8cGoySLbLISiCF4 BHzVT3WvLqdzWu5fzT/sf+KYAR59/v8A1Pd/y28gSeVLnWZ5FUPqTxcSsxlHpwGQRqEMaFOKyU+2 30U3kJk9K+X6CVqnzFptrrsLWEd1eXOoeVbbUJL4iK0KzEQSUjoYm/u0mIpHyEStxPFqcTizgATG 4CfKr7xf3X8G6OcUNpGN86/bXP7WoW1KGW3mvjc3GqwxLEdSe0kjmmWP4bWWQLQljbxwhqueXHdm +0YDSg/SY8Pdxbef2226XXRxS3EuXdv5IG6tdUfVUvH0z0ONukawNHdcRxAMTBYo7VX5KFHKQPt+ y3FcvEARtKJ+I9x+37nHhqBHIJES+RZV5k8y6VN5bhg0vy/HZ6rFFFHPqMloY6CJSPUZ44+bnxVq KQSGqtVONDQyMt5RI7rciHaRhLjHFE+7p+p7l+QOkT2H5c28rsgXUZpLyCOJndI0dVTivqBSo5Rk hewNKnrmXiwnHYPey1usjqDGURXpr7Ty8t/gxH9P+Xppaf4eluC14Uhuv0Rp0cfrQgTB1dpFIUtI zBnO5Zt/tZacpHVwvCHcEu0788PJ+icvqa3FmklFZk060iLonLjuJgOCHlQDYV2GJmT5pEKenz+Z NThlkjfUWBjd43/0aM0KMV7N3pUYoTDyzr1xd3xgub03DMrcI/RWGjLQk1DH32xV8T2+p2zQKsuo zpcb8kMsgUUqR8TGnT3y7wcXKhbScmS/JAyaxfOzC1vZZCrU2kYAbgcqgnbf8Mx5Rh/NDlCMjyK+ 38zay0al7q5owrX13Y79OpGSGGH80fJpMpd6s3mjVAvH63dlRvx9ViP+J4fBh/NHyC8Uu99JeZrN Lz8jPKeqSvIZbeCwPJQzSkTtFyIKnlX4ceA8hXI7fBEjtv3h5bqur2FpC7n6+ylGEEjNMsDSOvJP iYivTfKcWkyGrER8BdMcmeA/nfbSf+X9M0PU/wArbLTtUv7q0F7NLK5treKU8Yrg7VaSMgFqdqZl ZsJOSwUafIBjAKvqHk7yhf2VtAdd1M3FraRWkV4LOEzC2gWcNGCJ1PApc8XHSiDtgGOfeG6WWJ6P RPyW/L/SNNgttUsNUu72DTmubW0iuYUhCi5WFpqAPLUF4ww36ltsgYkHdRIEMo1rUIotUuVSEtIH ALr6RLtwChQrRk7A+P8ADAqC/S1igUGwLBA6lZEhUunIFaj09996D5+OKq1lrGlROIjpiSyktwnJ jFeL9/TWldq7VPTxxVFaVqekXl1GsWihQW9KSWMBwgkG1aAbda+AxViv/OSsvo+TNJn9H1xDrNvI 0J3DBbe4ND7Zkaf6j7nH1J2HveFN5s0RhGDoDckpVgV+Lx5Lw475k8B73H8UdyQetJfaxDOtr9UZ zGrCLkKsGHxDkQAaeBAxybQLXG5TG1M4cRmNGFtfuzAkD1qrXj2b1O+/bOfF3zh8v2O1Pul8/wBr fke1vk/NTytNcQyJznCtLKxZi6o1QfjkHuOmbPBOJhIRI+H9gcScZeJEkPc/zU0U6jNp7xzNHJHH OAouPQBqvwne2u6/Hx8Pp6E45gc2+cSeTF7L8v8AytK9wL2+lsf3cfpm3nLBVFQEREiiEfEP+xTJ HMx8II6H8vfJ8cSs3mW7dUc7kAsxK1IcFDtyNfhCjoOmDxvJIx+a6X8u/Jbyep+m7pnRq1eIMURl BKqRGtKtGHqa9PlR8Yr4YeqWbcrSBvVM/KND65AUvVR8ZUAAcutKZS2PjfT1he2X/cjeQN60okiS a3VAAzGkau6sCfceOZs8MCbMQXCjI1zK65vdKtZ0jn1jVImLBkkWSGUAVFSfTLEdTQZH8rA/wx+S nKRzlJDSeYNJKCus6o8gBVSBGqgCpX4fnSu/viNHjH8MUHUf0pJZeS+W5rSaRL6/a/fkyrKFaMsT WjUIO/Sv0+2XxhWwApplKJHM2+tfya/8lh5e/wCYb/jdswc31F2GH6A8isf0/BNNcXQVdOQoLP0Q nJg5Uyes0vJfhVa/AQQvLatMxpyHEfe5UY7Binm+JZNPhsZtKVRYxtbR30sS3V41vCgaI27wxskX KSR0ZZCpIAbkp6RZAvatZ84+WrTXL2z1HzXBYzW8xV4ayMwBJJUgD4SoNPfMsYpHo4hyxGxKa+Tf Onk281RNPs/MUGpX9zy+rWqBuR4JyYhnWteKMTvTAccgLIUZIk0C+SbbyD5g1TS7S5edYFnIEaPH cskqgsXk5pD6RCUo3x7bf5RWM9TjB4TKPEOYsbd1pjiPOkBqvle80KKWPUo5YGk+EI8TRqDu3pgt RuLA7bdN8jjy4souMgfdR+5MeKJ5foSqZLUIskMjCjEGOqUJpTYBgQBTrTMgRFc2qU/UdkHc/W4l CsGQgdGFDUMVavIV6imCQITGQPJ9fzWeqXn/ADjz5d/R1uLm7htNMufSLrGvGIo7ku5UAADrXBAg S3TkB4dmASf41vImFhoUcz28zrNyvbV1RgCCjCKRaFQ4FG9u+X8cBzLSePpF6D+WPljzNY+WrCS6 sI1vg8/qs4gmNJLh3NX5NtRj3yjLOzsdm3FEiO/NmyaT5pBG9pQ03EUSkVAqPsHxIyu21PNFttSt 7UrfyRvIx5BYkCBa9R8NAfHpgVAX2kX893NNHqMsSSfZjCOQnQClCPwyo5h5/wClP6mXCp22gT7G 61G6dgaUTmFK06GoJ3Phj40fP/Sy/UvCWx5cpuNSvQR0oDtX/Y4+NHz/ANLL9S8JRkWmCKcyreXX EuHMVG4n4lJr8Nd+NOvfHxo+f+ll+peEvMf+cobCDUfIWlQSryRtZgoCCNzb3C9/nluMiW7RmvYe f6C8B/5VroipLI8fCGCF55JHoFKwCMzlWoF/diZC3gCMs2cbJjyDeJNKcPkjy5ZXNlfW14LaSScR QSpMlQaqHZRWvwLICT0FR4jJQAJqmF5BXEdiyS78r6VO8Uk/mFpZuSrcMJYx8H2QVAP31Pv7ZfCI iKEdmyUbNmSYfl7pljp/5t+WI7G5kuoJJJGMryI/xei9QAm4oKdclP6CxhGsg3fSfmq4s4o4hczT w1rxa3416jc8iNu2YDnpXHrvltrfjK92xBUNMSQ1aUr8LdPh3xVz6v5YaNam726Lz3+H4+R+OnfF XDzB5ZTjIGvCx6ryPQU2I5UocVZfbyJLBHIi8UdFZVNAQCKgbbYq+P8ATTqL2UJTW7W1gjeRY4Z4 4WaMeq7NUu3KnIVHuc2BrucEXXNFQnWRbkjXtNTgo4RmOEKKbUqDsKAEH3wbdyfV3hQv9MvppvWb zLbqIkPox2wjT4wrhQEMiqNyFLV2Uk70oSCO5Eok/wASTa1pOpxWM9ddt7u3RRzi9UBnVArDgoLc vian0ZKJHc1zjKub6Y/La9uLD8ldNvraFri5tdNmnht0Uu0jx82VFRaFixFABmBn+o052H6Q8+vf zOuobK01OX8vbdbO4t1mu7m6svSKRxSn0JWWNbkrEODMlSexU7iuJI5O8f6U/wDFN4I80707zjoG p6NqV7HoXl6a8tYWuYra09K+avB2Pq+lGADzQjZiTv8AMygMhIHFEfD/AI8xlIAXR/HwebTa55i1 yS51qNYRHcT+rLPb28txAJZaViSSP1Ek+1UHke3jmT+axxIgZR4qujIA1300GEjuBt7rQWh+bbnR PzA0LWr+wj02GNpfSubqNrZZI7qNovUdpWqI1M1a8qU+7JyyieKXhyiZDnvxUb5bdWuA/ex4hQ+X R7mn5CeUUgigTUNVWGEERxi6XiAWLkU9OlCxJ+eYssMJEkxFny+DmCZHVu8/Ibyte26293qmsXEK CkayXnLiCKELVNhQdsrhpMUDcYxB8gyOWR5l4j+aOh6D5H1EaBa6fcXFhBNE9tLcyRkugRJZfTlj kjlWRXmCq3AUHiBm5xT/AHYFfi/e6rNj/eGV/ilb8uvys0DzTfaZp2pWxt7SRZL+RLcSRUR42VUU 3M0kstWETeokRi+EqHauVZQBDlybcRuXPmHvvmvT08uflsmmaSWEdl9QsrV5DyYIbqGEMxHDcBq7 f2ZgZOTscELlXkfsBLwjTtdby9oepNeP6ukasj3GsvGkctwokiH7yKFbken9bSVKylSkbsqkGlMq 4eIysmwaA8t9vh57/F2mowjHjx8AB2Mibvi5X0ogG64SdvVy3PQPyv1qbXvIOkarcWEzSOZqiJ3k VvTuJOVHkSRipZe7kgbeJy8ChTpybNsxj9Bo5Gm0q4kDnkiNJIKACnw8IxxHw9/1YUMn0GG0jtD9 VgngichglwTU7dQCzUxV4R+b9nHcfmLfiWwhulMNsEklIUj90SwBKsT26HKs2QxAqRj7v7WPACdw CwfSbIaX508u3UOnrFKl7DKTE5lLGNhSOOFPjY1G/EEk96nMjTZuOMvVe3d+n8e5oniEZDans+s/ mT+Zv18xaN5dl+pjnS4m0q/k5AOyqSrSWhQ0UfDRgQQQ1aoIFygBvf4/H47xJPJmsfmhJpkl95t0 qzkaaK3lsLLSA8VwPUUtKs630qKrJVduQ796DAxFpH/zkkv/ACDgTjZre/tZFPvVk/U+Ti15env/ AEF88+RfNM9vrGv3KlT9a+qK9T/vqJgP+JZMC1EqTS1cyeW10iFCJdMv5JIHAB3N+6DiCV/3/wCI yeMepombjH3plqEPmq5cGKIwRgKvorbxEH4gS9XnZuS023/Xl4pTxFr8u4NST83vLMmoFjNI7+mX RYy0awuFYqrNQneoxyVwGmEAfEFvpXzVcS24glWSKMAkEyvKu+xFBHsencZgOek0PmKWGPijWbhi WJlaeVia06kdhiqs/mhuEfpnT6sPjQrKaH6F74qvTzNJK6j/AEARswVXpI/FakEHYb1HTbFWXRlC ilPsEArTYU7Yq+O9Pk0E2QS7a55TerFLEk8aowWR2PwmQMBSo+nxzYG3BFUtXS/JBkc/UZAiUVg1 zEKECtR++7hvHt88NyRwQ7lOXT/JTIqx6fKssqVVfrMfwkA1PMzcetKAjG5I4IdyX+Yrbyva2ymx tSssgKqXlElCA3xARzP1JBFfDJRJY5IwA2D6i/KZef5SaItSvKycch1FWffNfn+oufg+kPMvO/5M Q3F297cSSX+nvyN1aRiEXSoDWNLcMhV1hDEKjUbgPTDUK0xjlJ5/Y3+EOjwa/wBCv9MubfUtGk9f TrZo2g9X1JI4ZHcTRwMOHqISUcsDx6MQfEmiGFEJ/wDl15L8zedfV13UZ47fSYLpYtS1C5aackTq aGkQdwIKcpWlkQAU5MKMcvjmmPSDy8mmWCMtyGU3GjW/lnzV5dn8t3drNFdrdNFr8DGS2l9NAJYY 4xNcfZXnE786VegAK1wTzyMaJZY9PESBA3fTd75jura/ktF06SRUIpNUhTUVrsjYGaGPm+9Chv0R NQ1IHI1oDSv2MVRSa5rL8CmjSMrsoDeqigKxA5HkAaAGp2r9OKp3irH/AD1+jz5cmTULKfULNpID Ja2plExKzxsroYSkg9NgH2PbDEWV4jHcMK0zyl+W3mLRYdEvvK8tlbpMHj0+c3AHONZJOZmikK0D XEoHJ9/D7OSnH1GXUpGUmIj/AAjkPe9A0TTNO0PSrfStKt1tdPtF9O3gUswVetKsWY/ScghGtcyB SQvIgVCjqfYVIGKrbO9+svKpjeNoW4OHRl34qwKsfhdaMN1JFajqCASKQDbyT8zfLOl3vmuW5nXX mmmhhZ200wpahRzj6yxv8ahF5Cu/LbocMYWN+H4j9rCXPnL4I/Qvyb8uQ3+n6zBrGrXRsrhLm3iu njCF4XqOaGCN6VX2yI9PIRHw/angvmSfx7npvrzf5P3H+uRqXf8Aj5tmyjcajLAV5RMyMyJzjjL0 MjcBVVJelSOTcaKNyQASCIyPUfj4oJASrzzomk615alj1e0N9bWxN19VWNZS7xI3EKjK9TvtthFs MkBIdXnXl/yX+Xt9IY5fL02nPIUEQuLSJuZZmWnwRvwoOLHnT7XscnISHUfj4uONNA9/4+DINS/J ryxdaQ+mW8kthCzK4a2ESFWVw9VAQCtVyMZyBvb5ftZ/lY95/HwSa5/5x90y6iMVx5j1WWMkHi7x EVFKU+Dbplgzy8vl+1kcAPU/j4Knk38jvL2h+a7TV4r7UpL3TqSpHdCMxMJFdAPUReJp8VVVqjYk UIrKeWRHSmMMERK97DN/OGt2+m3Fksmky6m8jMVaONmEQShLM1Co67AmvhlUY23k0qeXLrSru2E1 vp4s7gohuYJImUxsw3TmwCvxIIqtRglGlBtN+MX++o/+BGBK2RljWqWyyH+VFQHx/aK4QFV7K5W5 t450DKkiq6K6NE4DCoDI4V1PirAEd8SKNIBt88SflnpFpqgsUuNfEDPGZLqJIfq6mbhJVOS1ZR6j cuIJ+Gm9Rl0hGW5EbaBAjYGTIn/5x/0LWbdZ5/MWrXMTszj1+IblyPIlZIw32ieoyvFw4toRjH3M p4uPnKRUP+hXvKf/AFdr/wD5I/8ANGXfmj3Nf5SPeVG4/wCcaPKcBXlqWpsjMic40iehkbgKqqF6 VI5Nxoo3JABIkNQT3MTpYjveseU9Dt9G8n2+iwSPJBZJNbJK4BcqkjrUhR1+QzFyEyvzcuA4QB3M YtPMVhqExguNP1S0tzzK3FxbmlUeifApeT4qclqu1MpOln/Oj8v2tgzjuVr/APKnSbm7a6t9QvNO aUubmK0MIhn9Th6omikjljdZfSX1ARR6APyAAyAxTH8Q+X7UmYPRX8s/ltp/lqzuLTSL6e3hvL76 /dIIbMK9RR7cRrAI0hcbEIqtTowyYjkHUfI/8UxsIbWPy60fV/M0eo3c17DdLaSWyCNIvQaISq7c pBG55civFXcbVKr9s4JYZkfVH5ftTHIAeT0TLmDsVdirsVaZVbqK4q16Uf8ALirvSj/lxV3pR/y4 q2EUGoFDiruCfyjFXemn8oxV3pp/KMVd6afyjFXcVpSm3hirvTT+UYq700/lGKu9NP5RirgiA1AF cVcUUmpAJxV3pp/KMVd6afyjFXemn8oxVsKB0FMVQi6XZqoVfUCqKACaXYD/AGWG1b/Rtr4y/wDI 6X/mrG1d+jbXxl/5HS/81Y2rv0ba+Mv/ACOl/wCasbVWht4oYvSjFEqTQksasSx3JJ3JwKu9KPwx V3pR+GKu9KPwxV3pR+GKrsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdirsVdir sVdirsVdirsVdirsVdirsVdir//Z uuid:1fe77846-1fcc-544b-b578-2e2100f129ba xmp.did:a27f1412-daec-4631-8706-67522965897a uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf 1 xmp.iid:00dd99f5-d907-4f32-8184-07b5ec833636 xmp.did:00dd99f5-d907-4f32-8184-07b5ec833636 uuid:5D20892493BFDB11914A8590D31508C8 proof:pdf saved xmp.iid:a81a436f-69b4-4552-a28b-74740acee644 2016-09-08T17:24:37+01:00 Adobe Illustrator CC 2015.3 (Macintosh) / saved xmp.iid:a27f1412-daec-4631-8706-67522965897a 2017-05-03T16:21:29+01:00 Adobe Illustrator CC 2017 (Macintosh) / EmbedByReference /Users/benstones/Pictures/SSC/whitepaper/logo.png xmp.did:E36B649F24A511E5AA70B5B5FBF0AEFD xmp.iid:E36B649E24A511E5AA70B5B5FBF0AEFD EmbedByReference /private/var/folders/tr/fchgjsrs5rn9vnyvmzkymdxc0000gn/T/TemporaryItems/(A Document Being Saved By Illustrator CC)/XHjOYK.tif EmbedByReference /private/var/folders/tr/fchgjsrs5rn9vnyvmzkymdxc0000gn/T/TemporaryItems/(A Document Being Saved By Illustrator CC)/WgeL8X.tif EmbedByReference /Users/jonnyoverfield/Downloads/SSC_laser_logo[1].eps EmbedByReference /Users/benstones/Pictures/SSC/whitepaper/logo.png xmp.did:E36B649F24A511E5AA70B5B5FBF0AEFD xmp.iid:E36B649E24A511E5AA70B5B5FBF0AEFD EmbedByReference /private/var/folders/tr/fchgjsrs5rn9vnyvmzkymdxc0000gn/T/TemporaryItems/(A Document Being Saved By Illustrator CC)/djBTKQ.tif EmbedByReference /Users/jonnyoverfield/Downloads/SSC_laser_logo[1].eps EmbedByReference /Users/benstones/Pictures/SSC/whitepaper/logo.png xmp.did:E36B649F24A511E5AA70B5B5FBF0AEFD xmp.iid:E36B649E24A511E5AA70B5B5FBF0AEFD EmbedByReference /private/var/folders/tr/fchgjsrs5rn9vnyvmzkymdxc0000gn/T/TemporaryItems/(A Document Being Saved By Illustrator CC)/2Gy3Ue.tif EmbedByReference /Users/benstones/Pictures/SSC/whitepaper/logo.png xmp.did:E36B649F24A511E5AA70B5B5FBF0AEFD xmp.iid:E36B649E24A511E5AA70B5B5FBF0AEFD EmbedByReference /private/var/folders/tr/fchgjsrs5rn9vnyvmzkymdxc0000gn/T/TemporaryItems/(A Document Being Saved By Illustrator CC)/o1TmvT.tif EmbedByReference /private/var/folders/tr/fchgjsrs5rn9vnyvmzkymdxc0000gn/T/TemporaryItems/(A Document Being Saved By Illustrator CC)/VGYjT8.tif EmbedByReference /Users/jonnyoverfield/Downloads/SSC_laser_logo[1].eps EmbedByReference /Users/jonnyoverfield/Downloads/SSC_laser_logo[1].eps EmbedByReference /Users/benstones/Pictures/SSC/whitepaper/logo.png xmp.did:E36B649F24A511E5AA70B5B5FBF0AEFD xmp.iid:E36B649E24A511E5AA70B5B5FBF0AEFD EmbedByReference /Users/jonnyoverfield/Downloads/SSC_laser_logo[1].eps EmbedByReference /Users/benstones/Pictures/SSC/whitepaper/logo.png xmp.did:E36B649F24A511E5AA70B5B5FBF0AEFD xmp.iid:E36B649E24A511E5AA70B5B5FBF0AEFD EmbedByReference /Volumes/Design/Jonny/ssc/whitepaper/logo.png xmp.did:F70ADB39F51B11E6AF4991791418785F xmp.iid:F70ADB38F51B11E6AF4991791418785F EmbedByReference /private/var/folders/tr/fchgjsrs5rn9vnyvmzkymdxc0000gn/T/TemporaryItems/(A Document Being Saved By Illustrator CC)/9ftce2.tif EmbedByReference /Users/benstones/Pictures/SSC/whitepaper/IMG_2325.jpg 0 0 EmbedByReference /Users/benstones/Pictures/SSC/whitepaper/IMG_2311.jpg 0 0 EmbedByReference /Users/benstones/Pictures/SSC/whitepaper/IMG_2311.jpg 0 0 EmbedByReference /Users/benstones/Pictures/SSC/whitepaper/IMG_2325.jpg 0 0 EmbedByReference /Users/jonnyoverfield/Downloads/SSC_laser_logo[1].eps EmbedByReference /Users/jonnyoverfield/Downloads/SSC_laser_logo[1].eps EmbedByReference /Users/benstones/Pictures/SSC/whitepaper/ByspeedMachine.tif adobe:docid:photoshop:0cba7800-c4e7-11db-bf6f-8ed7468b4f03 uuid:0cba7804-c4e7-11db-bf6f-8ed7468b4f03 EmbedByReference /Users/benstones/Dropbox (Personal)/SSC Laser/Flat Laser Parts/059A8720.2.jpg xmp.did:79c262a6-a0e5-4ecf-b1eb-cc0dc80a74ce xmp.iid:3C50535E1E206811BEC59DCD57505F41 /Users/benstones/Pictures/SSC/whitepaper/logo.png xmp.did:E36B649F24A511E5AA70B5B5FBF0AEFD xmp.iid:E36B649E24A511E5AA70B5B5FBF0AEFD /private/var/folders/tr/fchgjsrs5rn9vnyvmzkymdxc0000gn/T/TemporaryItems/(A Document Being Saved By Illustrator CC)/XHjOYK.tif /private/var/folders/tr/fchgjsrs5rn9vnyvmzkymdxc0000gn/T/TemporaryItems/(A Document Being Saved By Illustrator CC)/WgeL8X.tif /Users/jonnyoverfield/Downloads/SSC_laser_logo[1].eps /Users/benstones/Pictures/SSC/whitepaper/logo.png xmp.did:E36B649F24A511E5AA70B5B5FBF0AEFD xmp.iid:E36B649E24A511E5AA70B5B5FBF0AEFD /private/var/folders/tr/fchgjsrs5rn9vnyvmzkymdxc0000gn/T/TemporaryItems/(A Document Being Saved By Illustrator CC)/djBTKQ.tif /Users/jonnyoverfield/Downloads/SSC_laser_logo[1].eps /Users/benstones/Pictures/SSC/whitepaper/logo.png xmp.did:E36B649F24A511E5AA70B5B5FBF0AEFD xmp.iid:E36B649E24A511E5AA70B5B5FBF0AEFD /private/var/folders/tr/fchgjsrs5rn9vnyvmzkymdxc0000gn/T/TemporaryItems/(A Document Being Saved By Illustrator CC)/2Gy3Ue.tif /Users/benstones/Pictures/SSC/whitepaper/logo.png xmp.did:E36B649F24A511E5AA70B5B5FBF0AEFD xmp.iid:E36B649E24A511E5AA70B5B5FBF0AEFD /private/var/folders/tr/fchgjsrs5rn9vnyvmzkymdxc0000gn/T/TemporaryItems/(A Document Being Saved By Illustrator CC)/o1TmvT.tif /private/var/folders/tr/fchgjsrs5rn9vnyvmzkymdxc0000gn/T/TemporaryItems/(A Document Being Saved By Illustrator CC)/VGYjT8.tif /Users/jonnyoverfield/Downloads/SSC_laser_logo[1].eps /Users/jonnyoverfield/Downloads/SSC_laser_logo[1].eps /Users/benstones/Pictures/SSC/whitepaper/logo.png xmp.did:E36B649F24A511E5AA70B5B5FBF0AEFD xmp.iid:E36B649E24A511E5AA70B5B5FBF0AEFD /Users/jonnyoverfield/Downloads/SSC_laser_logo[1].eps /Users/benstones/Pictures/SSC/whitepaper/logo.png xmp.did:E36B649F24A511E5AA70B5B5FBF0AEFD xmp.iid:E36B649E24A511E5AA70B5B5FBF0AEFD /Volumes/Design/Jonny/ssc/whitepaper/logo.png xmp.did:F70ADB39F51B11E6AF4991791418785F xmp.iid:F70ADB38F51B11E6AF4991791418785F /private/var/folders/tr/fchgjsrs5rn9vnyvmzkymdxc0000gn/T/TemporaryItems/(A Document Being Saved By Illustrator CC)/9ftce2.tif /Users/benstones/Pictures/SSC/whitepaper/IMG_2325.jpg 0 0 /Users/benstones/Pictures/SSC/whitepaper/IMG_2311.jpg 0 0 /Users/benstones/Pictures/SSC/whitepaper/IMG_2311.jpg 0 0 /Users/benstones/Pictures/SSC/whitepaper/IMG_2325.jpg 0 0 /Users/jonnyoverfield/Downloads/SSC_laser_logo[1].eps /Users/jonnyoverfield/Downloads/SSC_laser_logo[1].eps /Users/benstones/Pictures/SSC/whitepaper/ByspeedMachine.tif adobe:docid:photoshop:0cba7800-c4e7-11db-bf6f-8ed7468b4f03 uuid:0cba7804-c4e7-11db-bf6f-8ed7468b4f03 /Users/benstones/Dropbox (Personal)/SSC Laser/Flat Laser Parts/059A8720.2.jpg xmp.did:79c262a6-a0e5-4ecf-b1eb-cc0dc80a74ce xmp.iid:3C50535E1E206811BEC59DCD57505F41 Print False True 1 210.000000 297.000010 Millimeters Apple-Chancery Apple Chancery Chancery TrueType 8.0d1e1 False Apple Chancery.ttf ArialMT Arial Regular Open Type Version 5.06 False Arial.ttf Arial-ItalicMT Arial Italic Open Type Version 5.06 False Arial Italic.ttf Arial-BoldMT Arial Bold Open Type Version 5.06 False Arial Bold.ttf HalisR-Medium Halis R Medium Open Type Version 1.000 2013 initial release False HalisR-Medium.otf Cyan Magenta Yellow Black Default Swatch Group 0 White CMYK PROCESS 0.000000 0.000000 0.000000 0.000000 Black CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 CMYK Red CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 CMYK Yellow CMYK PROCESS 0.000000 0.000000 100.000000 0.000000 CMYK Green CMYK PROCESS 100.000000 0.000000 100.000000 0.000000 CMYK Cyan CMYK PROCESS 100.000000 0.000000 0.000000 0.000000 CMYK Blue CMYK PROCESS 100.000000 100.000000 0.000000 0.000000 CMYK Magenta CMYK PROCESS 0.000000 100.000000 0.000000 0.000000 C=15 M=100 Y=90 K=10 CMYK PROCESS 15.000000 100.000000 90.000000 10.000000 C=0 M=90 Y=85 K=0 CMYK PROCESS 0.000000 90.000000 85.000000 0.000000 C=0 M=80 Y=95 K=0 CMYK PROCESS 0.000000 80.000000 95.000000 0.000000 C=0 M=50 Y=100 K=0 CMYK PROCESS 0.000000 50.000000 100.000000 0.000000 C=0 M=35 Y=85 K=0 CMYK PROCESS 0.000000 35.000000 85.000000 0.000000 C=5 M=0 Y=90 K=0 CMYK PROCESS 5.000000 0.000000 90.000000 0.000000 C=20 M=0 Y=100 K=0 CMYK PROCESS 20.000000 0.000000 100.000000 0.000000 C=50 M=0 Y=100 K=0 CMYK PROCESS 50.000000 0.000000 100.000000 0.000000 C=75 M=0 Y=100 K=0 CMYK PROCESS 75.000000 0.000000 100.000000 0.000000 C=85 M=10 Y=100 K=10 CMYK PROCESS 85.000000 10.000000 100.000000 10.000000 C=90 M=30 Y=95 K=30 CMYK PROCESS 90.000000 30.000000 95.000000 30.000000 C=75 M=0 Y=75 K=0 CMYK PROCESS 75.000000 0.000000 75.000000 0.000000 C=80 M=10 Y=45 K=0 CMYK PROCESS 80.000000 10.000000 45.000000 0.000000 C=70 M=15 Y=0 K=0 CMYK PROCESS 70.000000 15.000000 0.000000 0.000000 C=85 M=50 Y=0 K=0 CMYK PROCESS 85.000000 50.000000 0.000000 0.000000 C=100 M=95 Y=5 K=0 CMYK PROCESS 100.000000 95.000000 5.000000 0.000000 C=100 M=100 Y=25 K=25 CMYK PROCESS 100.000000 100.000000 25.000000 25.000000 C=75 M=100 Y=0 K=0 CMYK PROCESS 75.000000 100.000000 0.000000 0.000000 C=50 M=100 Y=0 K=0 CMYK PROCESS 50.000000 100.000000 0.000000 0.000000 C=35 M=100 Y=35 K=10 CMYK PROCESS 35.000000 100.000000 35.000000 10.000000 C=10 M=100 Y=50 K=0 CMYK PROCESS 10.000000 100.000000 50.000000 0.000000 C=0 M=95 Y=20 K=0 CMYK PROCESS 0.000000 95.000000 20.000000 0.000000 C=25 M=25 Y=40 K=0 CMYK PROCESS 25.000000 25.000000 40.000000 0.000000 C=40 M=45 Y=50 K=5 CMYK PROCESS 40.000000 45.000000 50.000000 5.000000 C=50 M=50 Y=60 K=25 CMYK PROCESS 50.000000 50.000000 60.000000 25.000000 C=55 M=60 Y=65 K=40 CMYK PROCESS 55.000000 60.000000 65.000000 40.000000 C=25 M=40 Y=65 K=0 CMYK PROCESS 25.000000 40.000000 65.000000 0.000000 C=30 M=50 Y=75 K=10 CMYK PROCESS 30.000000 50.000000 75.000000 10.000000 C=35 M=60 Y=80 K=25 CMYK PROCESS 35.000000 60.000000 80.000000 25.000000 C=40 M=65 Y=90 K=35 CMYK PROCESS 40.000000 65.000000 90.000000 35.000000 C=40 M=70 Y=100 K=50 CMYK PROCESS 40.000000 70.000000 100.000000 50.000000 C=50 M=70 Y=80 K=70 CMYK PROCESS 50.000000 70.000000 80.000000 70.000000 PANTONE 294 C SPOT 100.000000 LAB 18.823530 4 -43 Grays 1 C=0 M=0 Y=0 K=100 CMYK PROCESS 0.000000 0.000000 0.000000 100.000000 C=0 M=0 Y=0 K=90 CMYK PROCESS 0.000000 0.000000 0.000000 89.999400 C=0 M=0 Y=0 K=80 CMYK PROCESS 0.000000 0.000000 0.000000 79.998800 C=0 M=0 Y=0 K=70 CMYK PROCESS 0.000000 0.000000 0.000000 69.999700 C=0 M=0 Y=0 K=60 CMYK PROCESS 0.000000 0.000000 0.000000 59.999100 C=0 M=0 Y=0 K=50 CMYK PROCESS 0.000000 0.000000 0.000000 50.000000 C=0 M=0 Y=0 K=40 CMYK PROCESS 0.000000 0.000000 0.000000 39.999400 C=0 M=0 Y=0 K=30 CMYK PROCESS 0.000000 0.000000 0.000000 29.998800 C=0 M=0 Y=0 K=20 CMYK PROCESS 0.000000 0.000000 0.000000 19.999700 C=0 M=0 Y=0 K=10 CMYK PROCESS 0.000000 0.000000 0.000000 9.999100 C=0 M=0 Y=0 K=5 CMYK PROCESS 0.000000 0.000000 0.000000 4.998800 Brights 1 C=0 M=100 Y=100 K=0 CMYK PROCESS 0.000000 100.000000 100.000000 0.000000 C=0 M=75 Y=100 K=0 CMYK PROCESS 0.000000 75.000000 100.000000 0.000000 C=0 M=10 Y=95 K=0 CMYK PROCESS 0.000000 10.000000 95.000000 0.000000 C=85 M=10 Y=100 K=0 CMYK PROCESS 85.000000 10.000000 100.000000 0.000000 C=100 M=90 Y=0 K=0 CMYK PROCESS 100.000000 90.000000 0.000000 0.000000 C=60 M=90 Y=0 K=0 CMYK PROCESS 60.000000 90.000000 0.003100 0.003100 Adobe PDF library 15.00 False 21.0.2 PDF/X-1:2001 PDF/X-1a:2001 PDF/X-1:2001 endstream endobj 2 0 obj <>]/Metadata 1 0 R/Type/Catalog/Pages 4 0 R>> endobj 4 0 obj <> endobj 12 0 obj <> endobj 15 0 obj <> endobj 3 0 obj <>stream ADBEprtrCMYKLab acspAPPLADBE-ADBEdesc,|cprt+wtpttargtech vued ^viewl$A2B0_fA2B2_fA2B1a_fB2A0`8B2A18B2A228gamt k|desc"Coated FOGRA39 (ISO 12647-2:2004)textCopyright 2007 Adobe Systems, Inc.XYZ EOtextICCHDAT FOGRA39sig offsdescD50viewe+| %z Rimft2 jP<-   vj_UJA7+{ f!S"B#2$$%& ''()*+,-./012x3c4L566 7 789:;<=>?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(魀Lڀ,O;M}\gclPb7Cҁ~ӉY~Lj~̇~ͧY$|#,f@O<O7O$}ؓ/}ّ}⏉}~H<~8z~_d~N3~64~,~ ||͝+|ܚ|}}2ю}dy_}c}ڌMG~ %5|~)}^| L|!$|8 #|R@|P|x)}b}LZL}}4}}S{߮{ʋ{u{֤@| i|Gw|8a|ݕK}4}0{|y{:A{FT*{TL{h{R{ޢv,|,a||KG|4<|ʔ|/`{z{{ߞ{Gr{!uT{Ҥ`_|\J|U3|g{zpۣzpƝzŸz׼h{{At{"_{Jp{쟗3|{Z%zڊzJŊzϰzēvzӽ.{s{;d_N{k)J"{s3{{ z٧zfĬzCzPzűzؾ*sR{^{'I{E3n{pzɑc@}YL}3{}~TtW~~vdTaK3d?1_ˇ)F΅:\O_u ``IJx3(Ã7Ɓ{=1h6d"'҂ t@و_>Id2t/9f>?sUqY+(eő+]pLr3^2HՊx1ԀDpZ@{Ҡ*oc*ەq؀]@NHS/1Y$lj؂K89ԀcpӀ3\nGg 1 PzﲔB_D݃o͜[=F0;<~|f%kME쫻orD[PFo 0w~ՖU}㩂[9~64UmnY#Z~~$F ~0@~tk}⣂?MZe.ǔIpGm~خCZ~E~e^0~!|}0т*߾ ='YeЮeCVi~]m'~Y~c-Ev~W/}ޞ|㕎|*ʌ|fϋm|<|Ǘ7}6ˈ}o~V[Q~Fo/Ѕ/w;κۊLNɉ2-ce02n\ Z~E/(rn6ߝOˍk+q"[ c wmYyDńbL.oݲ$^ΓZsCɏlX"cXzDۉ. ]Q!cmB.-->~m[akD;W;Ca]h-֌TgOںRs2Тy2Ɯ}IjM-1V჋Bӂ5-XR#*<ƈĮl?LJŅ\g|L|ivț,V6)BY-ޓ׺6!{["hmhU͜A&,܁u)ˀ^ֆM\xJ zo֪gUvAɝ,"yC̰pÃ󅍽@„Yyg>֬T,A)x,t-{1ԑQ5Yf'g{\xcfPTz@7,M~(>ז<{{n3{ | ͎6|{}"h‹)}U|~?Au~+dȈyڔ"ƒP TKqfz-Ng:T|D.@3+Q[, w򋒮WΎH(匿BxF|fS!?*\iiXvב@t,QX wÊebRR/?M*=)腰DŽ́FCH]H&+uncsQBCs>9[)!7U%ҩɗD߆àOtWbވPᖶ=˅#)se+Zbɴ#ubusbP 4=_X,)=70Rcɶ)n6β<>drψèaPuCOn='<)֗t4zȓK {/ރ iq`:Ng<(҃ŌNjΠ3[̂JﻹqPc` $Nvƪ\MQK99 g%LJՅB?ٝDϒ3J|kl:[06Jh8Ոh%"*Լ : S{rkJզZ̋I 8iY%ea+wԚī^?az±jvZ0I_ 8 4%7l8K- `E{/ʑGyiˍEY&H7ݢ%(e8yyz{i{p{F{kD|Zr}2IC}7E~#Aae e.{ סNҚ^zQOjWY:gH6"V .(+ߝJBaVy i##XGݐg@69[ " R KvTaׇ֙OxhBX,GB5ȍۈP"yz\ ӊ,ܙew%>jwgaWCSFm5`Z"N܋ XyߟTƜLٙv5(fVDF5ۏ_"29x ] $@˞iXsuCڜe˓MUCE4m" 7&ۢR; Ș?tbe(UJE#A"4\ !/) ڇL]'4!RskZd-TH+D4!׉Õ ~آ!Ž6ȗr.DclS D 3h!i2Hˠw0iڻ>qߕ bВV&Suج}Cz 3p+X! Rꉯkz |ztzG{Yr#{b|S[|}&C3}268~ %pL%^?&?rq<"b0R6Bp1ɒ' [bܬOJ7cEVM͆p`an]RWKB 1hv s=9~\0foI`ԊPQdՉmA1x8׈ >0/;+}g5nu_WP–ZAq0+d Vߦ/ܚ|xLmӜ _1P&@J0wk!}z WЇy{6jS{m(^O<@?'06w k_ݗ<2jLz͞lRd]4O.?ӒJO/󏏖KkZ Y_U&h(y؞zdks#]Nqܟ?] /.V #Lj5yFǖKxP(j\rM䔕E>/hܜWBu QPT3DžEdˡJxO.:j[rMq\>l+/32/j wm?z^్z zwn{RiB{[||Lt`}*=K}-G~1gltװсYvh*ZZKt`NfrXRJu;,DԒ .5<Igcs喤eӢXAI8;\3, ȍB {_¥ }3Ğr⥋)e4WۗmI;V; Ɠ+ᓐi* Іy7ݩ:r#=dOV|9I ٙ:`+ ;!뚍د~NqKcơVS$H{:P/+zb; {Ȳi^~1(pŮcUا/H +9+IU򏖒8 9/RñS} o酪^bUC(G騭9e?+" =6 ىV{7{X{P{mE{`|vSJw}E]}7H~(+Pjřv$JӇi|zK:mS`Rץ~q1Zo8#π)Ɂg.<}CL(pd,KWJKJo>v܂1%~#6ÜGyuQ`|ƿopCćKc˴WbJ>5&0"J⛰)nÈij||bocv勒WJ=h0Ρ=("hhψБ{oj{;cFVPDJht"=ލ:0"ݜ6׉20}{bnbVEJҒN=~80="ZӋ2z&njub2~U/^IEz=F0fJ"5ƗƄˇ¨zqťm aUIrÚ=! 0KN"𚙓0qq(ynmi]a PU>?IG<բ038|"5|;"yh!lYf`TڧHϦݤ<30ŝ)#ae^ڼxภl`ST_'HF<{ڤ0iN#({-~~r}f}Z}OGD~ C~7H+)Ѥ݁j~n rI;fS炜ZKO^?Cm]7{‚+EܣՄ'd+т~@( rf"Zv&NܶCG67^4+(>0N?~/m r7if+ZegN͵ҊC:Y;7R5*g^W΃}̪qwen"Z/NPCF7>n*H2HSՃU}qhʙfe{/Yڹ=NZWBђF7#I*Ɛ3D.r݃},kq;e-,3YVNB'E7 *Xxi<|pķ]dྠZYHMmB}6S+ffOBT;|rp8dX0M@Bp#6񧴜+™@ |r|`p;˯dNSXMpEBPg~6-+-6juG ֎>|ɰosdKXONMEB66㦿l+=ŝ' | ڄ|z]R|z}&{T5}{~}|}}xw~3}b~n~L~~u4~~~.U{{vɧ{݃.|V|̌|w}Hka}7Kz}؂3}2}y㎅z[džzыD{E0{%{| 5u|oN`n|͆pJ}3,}K|ux=yrŢy듂yzPoMz{5ti{?_^|I|u52|q|I.x)0xy'yzFzs@{a^g{}H{2|OW{wx(fxFxNxcjy|wyr6z]{HH{j1{uzvwz-wmx{;yхjyqPz\z3G{1[{(WzVvӈwrwxxфhy&pxy]\.z0GIz1zyَf3v).vܾBwKwϷ͖xU*fx֬oyVF[yˢ,Fz(0zX3yovdYvo wƧlwx‚x~ny h[ysFyȢC0zyv޺v{:5vըwhȞ)wx_ndx̳Zy+FYyz0yxӐMx?yq zGz{`+|q|]@f}fGԁG~0ԁ)~q5!)F K﫶$Bāp\F݀0!rtO]ތ׽H%у@ ob߆U[Eۅ/ʄ (6pZ_dxjFN"8 (n7, Z 8E9<.1~PhB̛~ʙQ~œ~q~3m~Y'~D~G.~~(g~~rȸ~>>5~Y~n~l~+XZ~-C~4.1~^}k`5~?}}}éC}@1}w~h}k>}BW}ÖCu}ɓ-}|Ɍ}}lp}aw}9}07}o}/jn}EW}^C}a-}4>3|@}/}d1}|ﴊ|Y|{|۪;i|VVp|B|-v|͘5K{̎fe}}0׳ |©||{|h|TU|BM|/-H|t_{ns}}nP}lC|˙|T|nRz|\hp|\U|`~B |Q -#|,o{"~ wg&ax$ Ixأy zH~^{$k*9{Wj|B0}},ʃ~u~K?+71~pXza|ihV^B|,7&Zr ^p0>"؆t{1hуSUi@AR؄f+BKPL¢V"ʅynčЌ!pzr*g T@B+>&-҈u.ߗ2$@y>f{S@*Yq=ԇY4ŭbƃxq-eĂR򁢑a?;K*ʍm vЪ)SK2ւwdRK8? ϓ*]MZ]/I(]өȂ4v.d'4Q՚;>g*$ܔc~ʌЅVQDq˃NR8D|uEKce٣_Qv5>4)s~M˞(* i;J ݁t}Rb7P$n=)R}ʑ2ͦ҂]n%msۀǵ b8LAP1=fh)~қ}Ӓ&vl7w@Ύ}x ox·yv[hzd4@{[Qz9|$=P|(}~]Y Tʌ(Nwru cP=CR(A 4&\DoKPɅBsڈb ݄fO<'݅fʃ`~Ԑ͍H)؍@frÈCa@NS<x('ӆIݎ-[=#~>قΑqH`-N+̌;~'9:K#U9 Μ9<~zrUp:_I?aMyTH;ou&~v`aݧ NJk*hoњ^ח#L߄{:2&̃G_&X/ dEn͆u]ąy!LH:..&fn%Y;ۋ_ZֲӈzG~]Jm%]%K49ƒ;&a>33^/.M׈C}xm\Wާ=K*9e랁&06E3٭֋tuL ||ݷlwo[΄(J9& T~uGvwqGxG~ّ y(nR.z]4zK~{8|$}_ ~⽣~7M~I~]Ò~r}|H~m|~\.BJR8c$<'^ )ybeҜ@3lX|D>l Ӄ[D6I튷c7ى_=#}c D1,Ҏh?y<{1މk/ZsIE'@7_ӆ#q mv#%4zKjYH?6I #E ŕ 3{ɏxוRi'-6XҊ1G*R6}ō#U LjF_i]9)b!.x rhRǘ`X;Grh6Rv#/ 6>ը-ݤwg{oWk᚛Fc5h#]Fg<ȳovڧof$VFN}5S"х-m߉/ggmu6eӊ婢VNfEʇɡ4D "Җ`oױwIJH?aՎE tve3U~4E_14"~S͡uuUvsܛRwawx3uWyfozVJzE{3$| dJ} nfN}y^}œvv}.~t֕~belM~Un'D܏,n3s / NJoq柉X$|67sɔ胸dTKD>'3Ӄ' Ƀ ?pǍ؛! rՔ=c SSC2Cn׋% 3DŽխ6󞒛0aܘd qۓb̑=S9nC {2Rx u_Μ\͚]ʕp=a )RXB1,rʌ Ҫy:xЍ~ٕ!'p ٙa7Q莑B12+ F@ 56\}Ѣio1B`wL>QH5fA51XKmZ ;E{$ڋ|䔑 nH>\_P➀Aޛ0똙H9I jeٸ[|]mz^P@j0'ؔ ŔOˉ֖{J2lԑղW^eOa@FXw0jW" ESuyFva>w@{xmx^1yOayz?{.|7}jݥ~}}Oc}zJ}l.Y~ ]{~qN~?IN.% ᧏+᠙yckP*\ӃN&>.T| FPދɣL۟ x܉j~V\?8Mw>$. G 4ۄiUPÑڅҟb_wLir[eL۔ E=I-ŏNՉ o蚱[ϞvћݔhИZɖ6LB=; -) ى['v{YhZ)͕K%<א-BArK %HܞV[R{u+)KgVBnYpK4Ř7K,:ʜY ;cKuvfxw+rwdvxVٞyHRz9ϘM{*|}DI|֌ |~}q<}acQ}V<~5H"~9n<)$À{G}קǃpwcU+G邢9₾)D,6_4|oiDbdU G+P8HD)63x=0z|n֍a]ToF8d)VAG%΋Gt]{B n _9`⑜S֛}$F0?8,)&bWte1҅ zmr`bwSR Eŗ͒7S(ې`iRÓu6b:yjAlO_RŚ[ERe'7dIU(̑arqΉY@~ک$x٥$kSZ_šXR&LDЗ7(El dž&x ak1^c~:Q D\(6(]e 񛎛P1$Nݎ/M,{oi{c6WK>112$6+ X;݉ӅQ8c{ anBzbݮVVJ>W1F$"ӘnD qo3nw9wQwkax_[y)SfVyGqz:{-|}Kŀ`}vػ}j}^~S{~kG%~:k-Ǡ%𑙂GmvEjs`^< RFߨ7:-i Zk/J恌\u9i$^;qRr凋Fp:V>-Y'q4ᐹu;iwrO]ɯR1#FQP:-kBQɘj``t¹Qhⓧ]H$QEp9ݡَr-L I'ar+tLhe\ٮQ=E9D@-2Fg X}F֌r^s˸hf\f$P٩EZ9pO- *7+~s>g[魱APnE97<,- %Yr[~e°Frcg2[{OPD9О,曹 ,ٕ{o$}߼lXrHf["tOĨWsDƦ8ܟx,ԛ\ 2r0ۊwDxlGŬy`*yYUyJz?h{3׫|p't}t~ S%? 8w>~lĭ~`/~~U~Jb~?KQ3Ū'iĢ Ђ?w;8kð:`r:UZLJJ.?873u't⡤ 읠8 ڂv>ks°`4>U>*J<χ?1H3 'C ,aIvsk'ޏp_hU%J ?R3'ģ%U x͏vk͖j6_TmI۬E3R'ˢ׎7Y [Hv B|j/_b$TaΖI>r43u8'ТTꎾ9f#-u¢CjU _T7IC>ԗZ3c%'ڡm#% niu`Gj/^к kS̴Ih>\>3Vc'ǖmH̗ЊXՃuҮi*^S$HѮ碟>:C3Kޝ ':Ғ1)Xtjwi|Ȱ^T5=SV,H?>V3Bs(Ț1V6IȋybtPyuz_v֯zwA{bxDdx^y4pYz8[zՄ F{\/{ F{GSt$uv/w4`w&xo)yiZzQEz$/hz0 z[sӜJt™0uN v[w(wn xYyiE&y.zMyʇ_߰s1<̩t˹ttuGv]w`m x)Yx;Dyy.y%y},r 8sѸBtdHu+gv|vۜxl*wXgxjDy.TyCDxMܽr+sstWBu~zvjkSw:lWwpCx.xД^x`qwrԾ(stc9u7}rv j~vդ6W&wC3xG-xaLuw%(qBrnjgsjatRt|uiv5Vw,Bw-xw@ qDrq(ts9Zsâ=t%{u~i/v8YV9vު9Bwf-wvstиuugvՓ`w[ylpzXzC{-|} ڷ~/}cȴ~'}~$}~+}k~=~1~~S~kd~}~W~%C ~i,~~|ƻ|҆<|S} }7y}W}dj;}V}RB>~,e~/~ d{<{܎{9|َ||Q||i'|݈U}+{A}i+}~}Pz˙={FV{6 <{S{z{.h|6qT|@|̊A+|݉|gzzU˯z՝zzcy{Qg {sT |(@X|F+:|I{Ոy0z*Yz+yڌxqqqx6x :xy&uCyn cty1Q@z >rz<*5z3=y;r;sЭtHvwxtxNfyfSzn?'{i)t|&w} <{Խ(|(|v]|}#w>~}d5~R~{>b~)1LfQqRƃVv(vcہfQ?=a(C ʊ܍͹OƁҋRq"A!&t׈Ab䀬gPR=p(KF[1ȯ̸}ǧ3ΖpAs0a 3O<׉'/95Nq𥨀D&`r'` Nt ;PC'#a~sőݨm*Pϓlhq1`'N*M;~ّ'~~}ʉ& C;~p~Ş[_a~M~;#~h'H~}:HqG%~{~o~az^~DrL~,:}e'}*|]ƀcנ0~~No ~ ]}&L|}ѡ:d}&}1^|]mxQР~i~Za~~ nj}ȱU]y}L}:}O&|#| {Ïqys *,tFu_vpw_axM>\y:Uz%^{ T} zLzd{h{ŀK|Do|^KI}WL]}9~Q%:~ ƋL0܊ܟljk2~ nyE]RK߁9F$ہ *ҾJQ*]$(}؆Rmv\t׆kJބ980$6 Ԃtʼ{NÈke֌φv*|lha[>J*8$e4ǫ@Zpw{q#kYdZI{#7r$/ꋬ;݇swIp7+o0My=zejoYMoH䂱79 %$[j,6#ᨡ6 1yeGimY0WHQGz6Ӂ#πۑڶ붜mβmυ@xi*h*XXtGB6h3f#gχwXΖυx)rhwgبW҂/yvXzɐz=zwQ{g|0W|FZ}R4O}!D~ 1X J:|HOvx|fVÉԁ#E+4sE! tʢM%ƍOurfb U*E` 4  T ̃G{~ lt\VeNj3U3D‡v3k& I O{ڂSsAdHATfD$35݋ 2 -(XUΎj"@|rK!cGؕSSC2ۅai q^ coU Q[ ŀ7q]bvsSACN2|L Iؐw ҈вf,ǧTpleaTRRB2] a N%yܶ%~DYoB`ǦIQpBf12o ׀ሮlܚ![}Gnް`XoQ6OA"z1l띆ǂ| Gp?QrCs4tpdrua}uw;Q⏠x`Ayy0zU{}訾xӚ˙Ayz }픘zo={A`}{Q|@3}10}:,~ .΀T;<׀|“n6À_PO@j/%"] Uׁ˙C^Ê-{vmK^Ǐ-Ov?߄/nxn Y1ZzDslUa^]aNf?bJ/ڇ ;%2=yƒbk\]:N@`>ۊČf.ĉFh) ,\=YbʝxxWWjs'\]M>fON.zŎчE l ȗ,NwXuw|i[?%M =q.)Pq 1ƗD5΄ԨuvhՎZ㞤Li+=k-͇ew\ ЃrPڗ+YtubhqZ>bKڊڠ<0-{gr i XϻOdu=+g{5`YURKgm<-9CV) }p桦r&usuutgș"uY֖wK*=xF;Βyk+dz${~tңx\yRytz8fӘAzY{J}o|V;QQ}+O})~؀Y~Îlށ)seqX?8Ij:+́-mFLφ#%r.e'*WLIO :yD*ێ 91%7q"&s;hqØIdS\VӓHp: V*x4T <%~pӘc~V,-H$9ʋ*\ۋ5.aVA;}/RpbǕU~Gv9=Q*$R7ӌ_ەݟZ(塾|Lo37hb TޒRG }8֍㓚)ؒ-6K🸫ڈ6{_nX增aHaT3FZ8c~ )iC ](_mzrm`S~FZ~7(q)M ; FE\N=yAlj`ܫS#e:E7)ߐ h\Rp߅ةBry5sLlNGtq_[uRXvDx16syb&]z{~Hx1xxSy7kyRy^(zQ{_D6|"5ŕ|&s}%~h7"اF.wZ:jtF]S}QKCq5uӀl&|HƋ(1rvy.i柨]:rP@C# 5+"&`fń}"O#Ō"uQ%i1\mOB4ؓ}&&kщaPـ;˘tVg[B4Nҗ鑤A˕)48f%90]"DӋzgoQs?fqZ}JNK|KA]k3%mEf~,rm4f6A]Y!Mb@?%39%} (ۧ;}ͣqle}Y`ԣM2Ƞ@q*3,,%D\rφHG}$q:ZeX䙖dLȖE@2%A8 2b*q[zrosbtVԤvJdwX=x0,y!zڗ|YwvXx7zOxnvywb`z VKzJ-{=f4|[//}.!~^T8~ym2aȦ?Uɣ6{I=a*/řW!́;TrOSE[xĭAm̈́a7UJcEIR"</!Ztrr&^Dx%pl``GT Hޞ-w؋ǯ]uG_i?M^.ZRbG*I;Ҙh.}h!BQ0bPEYBtZi+m]xR)^FПf:s.C?!%8^k gbztٱh]3YQǟbFc:y'.!ܖYi3s{Wrp?sBe t`Y|u]NZLvB@w6}x*@z1y{l <1}8${ uxo﷑yӚRPg΂MyiniƊc]*,X;߉aMAI6:)phgz<όۂx葿mݴbʯeW9.L2A\58)ݛ?htz2uzv{'1wR{Qx|Mlx|X4y}PCzZ}-ez~ z~-qԃ s-t;£9u(iv1}wjwW5xByvl,y6ycpm9+qr󊦡s2t|uivVKw߅B!x,[yiyweoSRp3q𒩠sōt{wu,lhv2Unw&TAzw+xXxZԳntQ«ooq3rQrspzKt7guTv@w_+wCwm©(o79>p@qNJrٜ!yFsfuSv9@hvݐ+_w1 wђm9dnpq).rTxLszft\SQu?va+#vO*vUclؽnD!o=poqwTs\e;tRu?u*v:oCv$IlڽkmDo:pWG q v|rdsR9t?Buy*uԘXuˍHlLмzmʌnYp B[q0XurQ~csbQtYB?u!*uhuґ|(ngU|;p|\q|s%|ty}ug<}RwST }x@}y*M~6zV~{AЊz#xWz|xЭzy|9{(zj{zx{{zf |A|#S ||?J}}U)}J}Z}~$]x|Mxfyq6y zWw:zʀd{IR {ʀ>|7)X|p]|Yw0ǻpwɉŪ]xVљ xӇyX.v yކwczoQKz#={s({_{ʁv#vϒ7wkwCxwtybyP}zKo=Xzň@(zZz{JuV!v 0v*w>wؓsxubyOy~0֠~%-~\~o~?]~;L~aQ9~}%f~}$~}Kj}F}D}F~p}Rn}`\}K]}9}Շ% }džO}Äν|x#`||׍i|}8|l|\|PJ}$8}@C$}^}{ۢ{ :{6:{t|)|l|4k[M|jJ |8'|$||[T>{^{f5{o{yT{%{ k!{Z{Ix|*M7|B${|{Ήzyz{{ z${$j?{@Y{yjH{7X{ʗ?$G{J{Vz`zz|zyEzī|i{zݧ#Y.{He{M7{ab${v z-zưrzqzaAzakxzubhzjXzGz+6{ #zė3!z;l͈nWp]tq{n8s\kKtZzvIIjw6x"~y Pk{")u Mv}wvx4zy j}yYxzH6{6-.|U">| ~U~*L~UK~y~xτ~iXFG|5i"4 ܁gz߆G2w/g1WRFӂ58?!ҁz" m݄$qsvzkefkVځxF)\4Á!†o O2[o͗eO̓BuTϐ/ecVE̋4Qzv!l h%1T?:Ã}ItVDeޓUJDM3!Au ~!BXk8sa̛dCh0TDcؔ 3{!~鏩 ~)up2`q[ӥrleUcmSCg3!A ~i }ˬF/-ˁ&4pqbSCRCR2~ } }Gޫ2cngϸ;pǯbXRB~{2{~K } 4|&ldyn-oۂ qbr\rcҊ%twSuC\$w@1bxr'y {۫ᏒtԎ%u{v|w{qƊPxcb‰2yWS 1z}}`hp}pY}aňM~AR:]~B~1R9f ̈́b#ښ߄&~4osr`هr=QyAʂ0ą" H@DB Nۊ|n_醼FP~@$0cp4 `~ Ɨh=@{ψ mr!^-DOX@Q/։߃*` V–ښ݈mzȇ8l2^0COEݐi?΄/Od* ԀɕiĈGQyɇ%k,]j>sNl?J/Lґ: `qDԔbuxȆȣ+jˠ \ڝM>8|.^7jo '߇ي Wӱmw{izR[M]]>AۜR.? FvˉĽs\j$w3;iV8[i?Lc=݂.>A `!l.iDn֔"oxВDqRjr\fthMcVu=w7-xJy"|tu@vMw)w)ix[{yLrz =&z,Ŋ{J|n&~{|E@|v&|h}`Z}K~=_nk~ qd+m5VÉHLj:@m+ 5  -z55u}@pcX V YH+C9*=脑x ZS.±SѮ|čoÌ@dbUn@G9O+*[[/Ƅ ~k=|\| ob v?TG4*8X * [ .ѠCl-]xm|oogq*bNrTtGFՑu7.w"(5x|y&G}*s0/t{unNvakwT2xF:y7Ez({3|=*z{zt{mP|U`'|Sx}SE&}7-p~\'ۍ ~RRڑ휩Ě&y`li_IR8EZ6э'E1m``Ή`MxRCk^蒎R D 6l'}ӏzwQO\j˔$^QYC46fo'FމڈF Ď*vsʔvj]kv*PrC|X52'HzO񍞚>uZi8y\mP&~B%5Ag,&҉mf]Ekt4ha[ OBnr4Ί&Ij؎х;՗sԔgb[RHN? Aaq4h&7╭R[_WޙGpڲs+vg ZːN~Ai4O4%? mO6lB~mro}fspZrM7t$@eu2_w #expy%}EsS}tZq֠u\evXYewfM8x?y2z#Y{7p|y2zP|zp㟚{Edܜ{X|=LwK|?}s1ؒ~#N~sMw ${od ΁XKޖo;?_1#EL؉@m'ψzч{ocB bWNUKG>P_1N&-#,KJюK/7ZDyˠ(n:CbjVJ>&b0#S|qÄUx maۙߑV1J8}=’/a0" }s݆k*_x!3hlEsa,fUxI=V0eui"_!‹*#ڣCwDڠk䞦`lMTϖM I%<ܑH60"t UpH_vxk+_˜CT:HTKqx%Mbm} bŢ"W򞶠5MB6g6Õ*Ȓ*rHgw[lZubI֨WcL0UA6,*ilȔntmTiy+n^֯pLTqIG#s>jt2١2v&&Xw+Ix ̙+{Sޏ;~sRsi t^yuSvHw>-xx2!y&.z_| 7~irzhz^{S[{H|=u|2}|&~NE hw GrW?gÀc]{RπHR=l2h=&j BP!qƴ%rgk݆*]ŅRztG77=_285&w3%ח :.q=Z\f߯ \wQ=7G= ׉2z&ff P!9pKfU>\r"QG,<ş:1՛׌t&W-  Œ yhYp,Leέ[_Q' FϢSu<{L1C`&A/; 5Èo}beHq[\P}FkǗQ<*#1g& ; un4dʬZnPM@FOQ;❰12D&Y <Ո6nk̫0d\Z;OE̠b;R1䛨%ꖞr TS_Ahnn^xo{TYcpJWq@WsP6OZt+v[ >?wy9|@%hz=tq^\uTI6uJHv@Niw6N;x+Yy j{$\|h=1~LW4h9zd^%szTzJ*{Z@S׀.IxB@%y6;+Ĥ7  Z5x+!KVӘЍ +B eq~[8RtH^ 6>ͧȚ5R*+p!$ ɑK<ł0e9P[}Q-H.>R254$+a_!8F feh`Nrj3.s%l5Vt#n#bu oJuqzvs[gzwtTaxv@vyww*yxfzyoѾotK*puH|r/v@sPw0thx"xuzyfPvyS_wz?xd{* x|fy|`m~o#~"p~8q~_Is~wt6~ewfI)wNgxE|k݇%mêo gpqlqńvPsjd:tRQuu>Dv}))vgẃ~j OlJrmo^pƋQu!r$c9svPt=u(v'w8i^kdminsx(tOgu@jgyiikȒln2q$o_qN6rg;so's̓xtԋ)Zg6hjl--m}p\o8_ApbMq ;rP's\7t{yfɓhj:Nkȸ؀gmUonծ8^pDMXq2;Kr6'sKt4Ux=i^xkty mzyoezq.szra{tOR{v&<|$w&|x }Hy5vrvt>wEu2PwvAPxwMr9y-x\`yy^NczzU;g{{5&{x{ |?|ut|Rt|hu|Ԓvz}w=}sqw}_x~-My~:z,~&'z~){V,r_s}աtbZ8uCvovN^w̓Lx:2yPs%y(CzqRurS'sMt>Vu*nv]vLwه9x+%x҅lyÃ̾np]nqm^rtobsn~tfmuXW\vMKPw3H9&w%Kxy ؼoXp1q/r} s*lt\uJv8wY%w~uxoynKpq r|skt[Au$Jv8Pvϑ$v폥w:nrOoxep~q{r ksZt Iu7vI$vfvwx2mynopq /z"rj>sYt#Iu7uԚC$u/wD$mѨno1pynqirYas&Ht7Xuu$fuEvҊSa~hŬ~jV~lD~n} ~pl~rr[~t$J ~u7w:##NxH yh|qī#|s |t;|uR{}vrkl}CwZ}xI4}y6~z"~H{k ~|Uzz){!{{Z{n{{z@{|RjG|#|Y|}}XHq|}6t}1~P"}Y~ }y{ayyу=z(ˈzy z؂Qi;{-,X{G|5|`"[| 9}"MxSx y &]y.wyVh1zSWz̆G{F5{~"#{ p|^f wQIwϒLxGRxvy+?g0yWzFhzE5z,!z {Sv(w ԔwxFux}*fQxVZy3Ezj4zm!zU zMuvl̒v߃watwAexxaUxEFy4?y䐽!y zra u^nu鑱v\tv٣sw[dwٝhTxpODyn3y^!cy4R $yuYu}&u)vh&rvqXӁ1bl0R0B218C Xrޛ{Q*K/m~ p5~ap~Ն`R ~؅B ~>1N~~ ~Ń~~y~dP}~Ko~9`}~({Q>~3WAl~DG0~>d} ~٦}֚5}Ø9}<|};n,}__}P}@}O0}d}Q }Xg0}Hmz}/ۉ}G{}mC} =^}O}@[}10'}";| 5|ɇ|۪O||z|llY|j^|{O7|?|/| |' Z|P|C|`y|Fy|6Jk|0]f|)>N|8?V|E/j|*{ x{|2`|v{[x{8j{߫\{էN*{9>{럗/"{˚{J {Ѥg)i߉kRk{?Qml`o^fyqO$sQ?,t.UvwCwSMzppqn ryskÇ*u*]idvpNTw> x-y>zƃ]|Ljwtxy_xyj z\x[{TM|><|-}J:},=2jwi%[WHLփӀf=f-^6̀π ֑:UمxvQdž/h#ZEL <򂩄r- K*%7Ӂʜ0|owcu/7gu,Y‚ߊ1K]l>~7=}r7}f|l~5Z<~M~@͌=3H$tGAtff}GDqyMeYiՃM-)w@BY2K$MvolWb|p~dՉLX(L?u2Oև$F@Lk{ݑIoc6WK?A1A#b'|Jc}zUnȐg6c+tWQ K^r@>NJ1#zki<7Py)瞟mߏb\4cVNJĊQ>Cx1+?#]ŌmWXXxGymaРoU.J>=ω,P0ȇ֗#`9<tu(_w/illHva~U~ܣIҊF=pڞ#0xn"ن$iȍ1ZzgwSilk`2myTǘo\H_qB<$Js.t\v3w6|]nvo pkG_qp_ƙrTt*HW:u;-v.Znx.+yntz~~UIuuivhjW4w?^x SnpxGƔ(y;S%z.%i{ |Ž`}:-W|3t^|ic|^"}BRi}G+#~/:,~-|( %G_~!Zsbh|-]WւRFK:wY- B91H˂};yr gqq\Q_؇\F :-cbs\%]|L֐SqE;f̎([xPӓ<(E L9-#Uʋz>!&{bOpٙwf0=[U}P@E9C,Ռȍ!sNzPzםoBe]ÚZg*O1dD8Ύ7,uI\tybo,آZd]*YOśD8g,ޕ x(#HyxΚny}d PYpNmHCI8YU+֋qkwyigljbUwkW{pmL~oAfqj5vRs+(LtߕvV xw5} vnlA`pa!qyV2rK\t'@u51+v(xA y {t~uҨwu3kxv$`wVMwK{Ax@y4z({-n| iA~Z.tT{j|`:|U|J5}a@v}4~y(pM] b3ztY iԣ _ TJ^P ?*4Q-R(L]_% ɈHsRxZi>^֟-xTiZIܙ?@߆Y4v'(!O$`y :Ӆ&[!r~ˎho^BS盳Il+>C~3։'aj jކuVq7g]US^ H_>3qE'ʑ rR `傄qg x\d RǚhHtӔ>,3T'|#.eO C3TpT/fc\aRAH[ =[2ɒL'J9 < : ݂oWe̟[圐QՙUG7=h\<2'v ?E}lhobjWXl*Nl8mD+o9աq.sH"Μ{t vpy0}l#nb,)p$X0gq{NrCݣt9uu.v"ݛ'xQy |MTsktauW.vMwCx9[Ry.}oz"{D| {~׋lajͯ{a{W%|%M,|C$j}9-}.VM~S"  ڒfJj*H`l`VqLŁvB x8ǝ8.+V"΂ƃ6 /1(i2_VJLE0Bc8~u-"ٔ' { jh_`-RUKJB=8>ˉ-ؘ܉p"ۖ1vވ <kсhcH^ۨU>K~Ab7--:K"ɕ  .d!g뫮^Y}TO"KA]“t7]-q" ^ g|g[]٧Z9TLěJlA 8S7g-> g"W Ŏ .fê&]cSTJ]@Ŝȝ57/R-"q蔻H D=F7a_iGW¸RjN56l?D9m;EQo1qz'@sEwtbxvјz~a-oGWpANqUDr;3 s1KuY'vxLϞyX |`ܹu)WQuMױvpDuwG;x<1 yG'zj柤{/;}ϕ![`oN{VM{QMY{D9x|":쨖|1}`'U~Z~9nK3`MVBMCICm:1c'<72lؚ3~_efVLZLcCJ:/1`Ӆ4'Sb[0(qtU!ɀ_gVL@Cyɉ:Y;1D'zQlqJ x_uU/LrڏC=#:(0l1#]'ό&ˆA0^UgxL&B@9s0/'uÎ˖H[[^YTUXKjBç9£Ζ0Ӡ}'y 5,~^BTѮŠKߞBl9I0'i6f *!^ȁ ne og pirl(s7n;sGt\pBa|ur0O-vt<wu&xv ywxƹk^nmpx2nq;psQ+qxtrru`ctw+NHgŠ;i؉Ck\/m^no ]~pKr<9vsI%Jsuւtd6wfxhҐCjP}l{mn8W\oފK%q\8rN%rUWu'3cA.e#g蘟 iՖL|klm}[o.Jp8q$r1tb}d壉glif{jklҗ[nIp^85qJ $q@t2ua߯媧d@fx\hozjX)jl2ZjmSI|o'7pN$qDsfaDceWgziͧj)kYmkIn7p;$}psN/`Jc0EeyO:gnoyii[ik8Y^l@Hn7fo՜u$ep&+sAt1dK#uf2ui`vk}wAmm wo[xqJOys7z?uc#Azv ~|wqmì+rojjspMtrz|uskv{uGZwivIqxPw7)yx"yry { zoav/pwɚqxs yCztyjuzYv,{`Hw-|6x|"xS| z}lmQopqQqyr̀isYu)Gv'36w4"RwM yB۵l䦓m*\o,vptxKq.hr셓X/t#G@uDo5v("val 0x{$jᑨl4n*Άo|w pЌ7grWWs\Ft5#uk!u vwƄ "{rsCutu9qvkb7w%ZRwB{x1yD<yR e{ة+q7rs~tpuaEvSQw)Aw1'xx~e zFѧpǗkqs}s ot\`suQ0vz0AWwL0wwĉ yup Ҙq3jrA|s)n(tN_tPuّ@v0vwDUbw yFoKpXqc{rjmCsv^tVOuC@Xv0!v@v Fx0o͖pTq zr Sl}r^;sӟOYtF?uK/v1r!u> jxN@nWoQpHyq~#z..~I{~T|!~}v{j|xV{|݆|}4x|A}uj|q}\|~M|~m>2},~-}a~}}[%p~zzfgzw{'i{hw[{8L{=|R-|g|mq}Svx㌊[yzyvzDhz Zz߈q={-"{̆M{ |nwxyuy{gy׎Zz/:Kz{p|Tch|VD}k~_ }?RG}і D}6}("}W}|}s}̨*}ڦRw0}ѣj}^c} Q}eoD`}K6p}&'|֓|\4|}т[}v}xyjQ}N9]}/QH} C|6|Ś'|mPn{R|[mb exThkjO^׊}l}Q؉wnCp5Wr%t1uQ;yΎݍ]j),lw!nvjp ]܉!qP9sDCRqt4v8%aw؆xq]2|Hr(su܉tiu\vP3 wBUx4y%mRzb{˃H~Cyp?z_tN{hww{{\|Oo|B!C}4$}%K^~%$K~,zҊ*8s3Ngpk<[@NOA\V3c%}8><)}rhSzfxZDgM.@3L)'$ڂ?@Ԁڃe|KqteٌY.MN@k2삄$uEd=)`{Xpd҄7PX҃LZ?k2$f^@gSG֝z=o\ddYX! _Lmv?l咨2a$Ə.NhbYz3nكcT9sWK>ts1Àꕄ#؀D`_~y@F-n7hbłۤW =K7>H1x9#ڔ ~ꍎ~Xdcz@enۓ$gc{j*WlYJjn=ٍ%p/"r^!t ׋uf_HzjCy(l3mڑnb$oV=qIJ5%r=Rt/u!KwS)x߆5|Pqbwؑrl"ta4uUnKv8Iwb<ъx}/\y )z\{RA~sxxrvUy=ky`AtzT{-H؊{zC 9\ݔ.ޓ#܌iB  fhS_dU+LnȜB͒9qn.r9#ŏ` '2 )eS}c\eRhHj&?0lB5Wnf*bphrC\s{w&}#di[XkR'm[H$n>ߠ;p5lr\*t6uw/z~Ud &oZqPQrHs>u 4ݜ"vX*uwFxKz:x} dcjuZIvQ swGx>"y4zl*Op{XOc|M=}]9<W;b| Yh|PV}G0z}=Ŝ}4O~*,]VCxGCbYpPf)Fʞ-=rH4v* v[H,aqXkO#FqÆ=*3ܘ0])𕮆X_oّ!؋pG`ٍgX)ȌO@ь2F|<ޚ93zn)͔#X f (`n!>WaNɟvEBt<3a͎)GOD4ۊr 5W:P_z.W1lN`tEYsרNx 6 x-<|y#z| G}3t&XQ{xP{GX|1>"|5ᣳ}A-&O}#ʝJ~r}<Xi`#5Z-W#ԜE(뙑eWق@4+X(4pOFܨ>.Fn5]-m#ݛcA8hdWծIO: F_=l5l,蝴R#ܚZ2 產9܆WpGN4?FSS=5<;,Ɯ퍐#Йƍ8DՋ <)WŖNvpF$>=˓@5v,A#Ù~P8LKVANDךEޥ=^.4,{#YTO osP>j _kbӝmSewnhJ} p#jl{qm[|roZItAq~7u\si#ut Ixufihkjmlo]{n&qkForZsqStKIru6sw"t_w ewmxd's@ftEhuNEjv\zFl[wXj'n#xNYoy4HGqmz 6Arz"?s{ vk{a|adj|vf|h}1y j}~il}Xn~ Gp4~D5q~i!q~U u~P`~Dbe,sg^wiyhkTWmnFo&59pz+!p tγ^}aRLiB~k;p&lbaWngQpAqv1rE~r qvAcߔ]jbO!lğ?n[F/od$ok( |tqĨv`^暡vavwnd}wgo5xi`Uy$lmPyn@`zp/.{r{ssT}av]ssgǘtPiu)k|bummvo_(wqOxVs>?y%t.yvPz w$|NyNq pwr)qĉs:s zt6tDlu#uu^vvNvw?wx.PxyxzO{[{o xEpRyqz/yrzk{s{M]*t{N"u|k>qv|-w}Wmw}y0z~7mPfn[/pKxhqK2jdrr$\=sM`t=u-vVv~|yeUk؉0mqn1w9p0}i[ql[Zr9Lsх=Pt -=uEu>yijlPjm܏v3o4hupZqɋNLs $n\,goTYq KorR}vpvcYwsUxGxǀ92yl,)y݀; yD{7r-s|7tZokubXv{`U"w0G8w섂8x)YyxQ{BqÏ~r{snmtЋayuTcvdFw*87wׇ)x>Kwzpݖۆ]r Hzsmt`tmSuFv{g7w* (ww%Rztp.Zq]yrpls\i_t=MSus끱wŁ4fkց hxjkl_nRp}DFrG5s&0ulEvHez nHA,ow9r0is!ɄIu@ZvMz˄Jm_yąon,pb߄r V9ssJ؃t=qv10J/wq! x҂yk_|ӃXtxumnva2wVxJ%uy=l6zY/ { !{|~ | wQ|lRC}`}hU@}IpW~/<)~/ ~!|9">Rԁv(v$k@4 _TnHu*:+f-n t_jxR`8,VdKאA:1a5΂;)Wсvo)sJ/i^_7Uڃ헇KmK@܂D5)uXێot퉙!riݡ$_r0$UjuKٛ @C5?>)A]txyB~͂rҙk^sia8^cTfdJ1h?;kg3jLm&_oǎqw szqNe;h~gl^.iSݒ/kIWm>o3 qv&s/zt x]w|pwkgm]85o-SpH$r=> s2|uE&dv w Ɉz"}orf;s\ItR>9uGv=dx2I?y&=Wz({ |U,ng^y&ey[pbzpQ{GS{=B|g1'}&B}3~Y Pŀmmd+ZLP܌*Fȋd~RT~I 0?P6 +ێM یՋ ^c2ZQДH7?Jo5َ+) ̋Մ8n A dbZ QK)WH6`>s5+|e ه n:a4YtDPcGÐ>B5I7+E Hj v|Fa]w>X瓕FPEAG_&>@?5 -+T qOe 膇 e`ÔʜqXkO2G`)=4֌"*튚 W 凼 l6^D^U_5a{LXdCqfi:47h0؛kF&mhwoN]q ve|]p7dTߤAgLi7C k,9ޜm-01o2&6qrtzx}\VkT1lKncBo9q0\s#>/v<w܍{x~\pSrRJusBt9u0Yw)&D\x\y0Vz2N}[XTvRwJn(xAy8ǘtzZ/Ԗ&{2&)&| |p~(?Z!|Rk}@J }AM~,8k~/"#&ϑb_(؊:'ZZQI@͂8A/{A&6FߐjᎣ0݀^Y QI?/@Z8$/No%a叆4VEЄ9Y%/QPHәS@U<7֋/_%Ґގi XhPHt@ N7a.% ֍.+:>XRP:UH(?˕7O.ȑo%[3ύ^D`S*7_&JapBc:%f1hu)j\m+;o: "Lr 㒐wPE}ReJfBeh9j1l( npr Uu*Zy~R!jJK1l9BCm9UoB1[[p(trȜt7ěu 䗑xDÏ| QopIکqAr9ss1+u1(؝vxϛuwty 3{U<~WQnvIv:vAh]w99{x1ys(ɜzd{f2|} ~=} Q8{I:{A-.|g9 W|0q}(›~4~s 3ڋxЀPH@'8X<0ϝy( s( -)PJH@*8a0( Ӕ, jl! UP1H^@{/8~fB0 (ъ  _FȀ/OťϐH &@=Us8N0cʎ|(~ L S`ËK Ï"|ЈvUPOdTGĢ[@ 8'ړX0E!(jk , pd:jkeZڣg^iCaLjdculg3eneiUplDqn3rq 5s0rw wtbdxdBfǒf]ihhk`tjemydlUo~Tn4qiCos52qDtqru qv.*rx YrxwzRbu]Sdv:fwyhwkbjx]lyMnz\>Fp%{ -q]{-qR{w |ա3`~ b~1e~]xUg6~jJiJ~\kQ~M9m>=n4-fp3Dp)%u-cgfIYhQK\jpwkkmm'nenslopneq%qXrlsIsu:Stvb*=uwux"*zCzi.sMjt]l^ur3mvdolwW2pxHrHy9szc)t{t{Ooye|Ig)|h|{~j|qlW}/cm}VTo}H'q ~,9Lro~n)sj~s~xew)Ng]|i:ok ]blÃ"UnnG|p8qrn)[rk9r'w%]c%fA{g`niމakTmwFo 8apc)qqɅVzwN/b̔$dzf~yuubL;udyvg0lw;i_wkRxmDy[o6zq&xzslztqU}bxKrSjvsSl5x,tMmku=o^v"qL{}Jm{?D}o1A}q|"D~s&~t%|xֆ1y}iwzykPoz`mcznW{ApK{r9>|s0|ruG",|v}1wM^~{wFqywr^nxnsbytWyuJzw>&zx0{#y"{zyF{zn}}qugxx{vyQmVvyawzV(x*{8JBx{=yl|e04y|!zU}Thz} | sw-t l%u+`vQEU@waI~wxz.}orp,3h1qL]tr_R]sdHG tV; u.Ou u8vՋ~yYt]i{`K^vc0RfG|h:]TkS,Smo kq<0wR}aLsWchAfr]ShQkFEmJ9o`,aqKr tay|Thq]jgG@l\G}_{8B}{+}|W~|X~U}~Bx{~n}{>~sd'{w~Y{ N|NC|P7|+4|ۀ|S}}X6~6wymuyc@zRXzqM{7C{a7R{*{| |1}IvfxlxTbqyVXyЉMcz7EBz6z*{1o{4?{ąa}upwƒkxaxWyyLyyB&y⍁6z>p*dzy]zm{ Q|twjwevaw֗VxZ~LxxړAyPm6Xy*,yݏ;yÍmz2|)svQj[vɞ`wGVwΛL"xX!Axٗ;6y4m)y^X y9z)W{ڂu?YkA]a`6VcKe@Xh4k/'mpo] qxCsߊ5`jFc` yfUhbJ>j@ l448o'zqr ԅ,tzar{ghӇ5i^톏kT mJo?e qV3s'Ftu w|@q,ngGpQ]qS΄QsI_tq>ʃu3WIv'$x̃"y$ ^zT}p%ufv]"wRx{HyY>8;z:2 {&߁{΁|s k}zo0|Me)|\!}MR;}H b~!=#~2~&RÀ ˀj}n)>d܀[^QG{_=?,24&n؃- abm1&wd ZP)F|<WB1E&;2~} ~΄~ЁlYEcI OZ~ݎPx~ʍF~<~1~1&~s~' .~$w~Tk~}b~NYz~+rP~2F5~<=~ 1h}%}Ўy}s >} }j}˝Kb}Y })O}E}<}c19}%}Lf| L}&P3}*kCYa㒧]Xw)`NbDe:lghz/j"m2 :ozr^yj``?c%WeMgCjH9ߋl.n"ZpTbrRQuq}{Qhڏg8_Gi5Vk&M%mCQn9S p.\Lr"t"uyx,|gm^݌^oAUƋNpLV^r+Bss8ˆu-v^"bfwW0]'0WNo$ oSVZ-Nҡ=]"F_=b5?eu,]h/"$jOl oit|(Vbh`>NUbFe=gl4嘭i,"l"vCnAՔUp; {r^w}xUEmj7=l"4n +o"_qs 0uNz '~TJlLmDٙo[<.p4"Rrl+s">unv rx|GT(qLT|sA:l݊3+$afl+YÏ }, HkKA_/:=S2+͎$UpmێB !xajUcY.e]I|}g`mimc^kQfO5m.i?(nl.:p*np=pEvr%]-_n_bGXbRezdglIfj]hlmNAkn>`lp-nMrnjsBuuYh\j_tlyyan~kdvp9\fqMei$sx=k)t-"lv#lvntxVq Yr؆+\tx5_u2ib`vA[dwHLgmx9= iy,jyMkdzs{d SznjWlzZ{sv]{h`|KZca|Ke}ag:dotigf,jiX(lkIwnqn=:p pY)q2r,~qs$xv_ghb0i"d~krfmdho{W,jq=Hlr9|nQtm)zouZp;v\vx\p4_q~brqpdVt5cfu\VHhv|Gjw8lx|)myF;ny-v{Z6x1]7y{}Q_z&pBbkzbd{8Upg5{GBim|08okX|(l|>m|uH}{X[N |^Go)`܀ackTeFh58j,(kl]lڀrt' VRY{\n6_w=a*b%SdF#gB7i#(}jg&xlZt Tؑ;~XDz[qm\^C`qaPSjcEf&7dh6(bik^sS>zWy'Z`l]@_`ARbʐwEXeG7.gc/(UhjʼnsRRV/#xcY}k\h_C_B&R~bE d7f(MhjG-rÅQݩpUqwX£kh[^^R(a^DcL6f!(Ggi፧[r|m2UCn]YO{Vo\nBp`4`qcYSrflE@tiJ6k&Lv!n;wow{lsip^.{kaylclmf_obiRwpkuDjr#m5soo%t[quzr7zFv f#fh hx-ijkkl^m1nQnpCpUrC5qs%ru?t uyByLZc1n%egpivg|qjTias"]k2tdPluBnv4p7w%dq5xryx^{`wc.wueuxi7gyf\i}zOkfzB_m={N4.n{%.o|Gq|l5w}#^~Oa]"tZcUh-eq[hO'j Al 3m%n?pv\!_UsRbXgGdpZf܄NhAUj3}l$mbaovKlj[xw~^arfaf{cwZLeĊMg@j3:k$lo*Ou˃LZP,}*]Dq``ebxYdҐBMg@i&Q3j$knvu^qYb|]\[ p_"e+aY5dM#fN@Ohk 2j2R$k:n uX{['pS^hd`Xc^|Le@gӖ2i$jm:tsUf~tSY"ru\fu_Zv~cMmw?f ?xh1xk"&y|mzoc}~tG"o]}Mq%`qZrJc`e6sGeXtCh|Lbu;j?v4mG0woj!wq>y.rG|\wOle{nHgoojcpl Wr+mK}sSo>btuq0uvsH!vtwuv?{\yimzBko5nmkpbnrVp8svJqt=rv0+sw%!txvxz{{Ƅ>gucxivdm~kqwQam x V nxJoy=Dqdzf/r{ !{sJ{un{y}e|wg}HlZi}`k}U0m0~-IVn~ps`*t8tw(zl_viΉlkbmVX.nʇMipBqXl6rp*sJshvq,y炚vh&ljQalOdWm̍WLo2RB'pW6ql*qrytrƉuՆQywuWgEklia`ksW!lLnmAoϐ=6gp*Jqˍer#uVIytfgjh뜆`jVlGLAm˖Ao<69phF*+q<Zq{trx҃wUZlYb#y\WmV_LkLbA7Qe5wh'k yyGw3yx&zdyzz |H| }~KpՊb56e*9h:_jSl8p@yWbf\"Y(_ PՊaaGdy>)g49i)kMn oDtza8PbXeO$gfF܇i=k4^m)o;qs,6wz|t`iWkOlF!n<pY3r)GZs(|ӀT\%TȀ7L]DЂl;F2Sy(bL);7A\ ~T6~L%~C~:~P2 ~(p~|~^~>~W~ŀ[~},S~K~PCk}،:}͌1}ɋ(V}!}}yB3~,~`[} JSK}wm p0Iu|Wb'OdGƎf?Oi"6kH-ml#osGqOsXw}qVhLOj\GlL>n 6o-[q#ʼn:s(Kt9vrFz|J~VncNep Fvq>1r5tF-Ou#vZExv=y: |UctJMɉuE)v=Ɉgw5cx,y#Uzq{}~ـT#SYe4S_@R9Ki8D"<[4X,8#TqAijZOҞUHURY@P\>8_<08b8'le+T^gj? m+sZ{OR[Gٙ^@'aP8;c/蔲fz'Ci P3ksm npv>/}NaG'1d ?fd7h/j'YLlD=o:p s爈x~LMߖgkFi>k75-mM/7o'p.zrXt; v5F{ g[Mm.E,n>p6אnr.&sl&t-vEw EUz}'LurEnt->,*ut6v.ƍw&ጂx-&Ki7?z 2 2[HEmU>X7[[/s^(:Wa kfdȚgPUjn`ot|E+}[_>>*]7 `/c-(&e y h]jmeeqwwDU}Da =ßc>6et/ug(i yl$pnSAptV^yD(f=Jhw6Pj_/+l>'֗n co-qwsw{Cl<⛷m6 o>.p''rM fdsTumw9\(z}q4CqZ< r5ߘ7s.ߖfu'v\ |w@x]z}8\+Bښ?vntZxwǎIV-k4Yfmu\\ni8^p]\kaqOsdsFAfyt3uh|u$Tiv-mwHx:zZS&sVttyYuh \v[}_vwNb5xsA2dy63fy$&gzwKlhzw|ʋ.P{XT^|(sZW|g Z|Z]}3N`}w@cI}2eo}$f~ks~8{v Ne~7R[}rbUPfBY+Y\HMs_Ig@Mb2d5$eSjvLy}5PqTi eW)YLZKL^q?`ۆ2fc $dL`i鄣CukJ=|MO2pSdVpXYΎ L\?_ڋd2[b0;$;cpTJiEUtI {NYpRdQUwX_X֓LX\?_2Wai~$Yb"ht|@HzMooQcTX X #L[V?^R2T`ǒ$qb,9hPat&hDQ~iUrxk&Xfly\Yvm_Lo/cY?pf~0qia!rkumGW| rncY}e\pg_difbXMkeKlh_>[n[j0ympKzMy|ՂsWywAZ]zhk]Xz`f_{sTbu{Hd|P< g |.h} i}koS}Cx~-Tav'Xloj[k_^ULS`0H.c;e׀.g hnxÀS!u1Vuj)Z ^\8S`_GbO;cdb.cf g.mȃwN Qdt]UP|isXx^L[HR^$Gka: ;1c.We fψ{jm)KJw~MPlsT$rhW]Z=R]G'`P ; bَ.PdH f l`v}OyRsS0>hbV ]kYR:\F_:b).KdCK el= vW݁nyQuoUj\pX^q\VRr_Fsc9tf*,4uhovUkV yBm~Cs+jAY+tLk\bhmh_v]bnbVQoe"Eq+g9+rmjv+slFt6n 7wpV}wv}farhcgpj[f\'kh[PmtjDnl8p]n+Mqp"r?r; dv>s|x|Pc+hqWejfLgl[%inn_Ok-pDAlq7nus*ot{psu tvI|$zz`Wppbqe6eBs*Z2gDtLNi0ubCkvr7lwq*n*x[ny sz {p|y]wn`xd3cNy^YUeyyN@gzC i}{7kI{*l|0 mw|r}s$z~xa[2m^_cTaXcMfBh6i*YkslH!Sriz wMZnl]0b`Wbo:MdB-fc6h؄ *>jX'kHq[yvdXl6[Ɍa^Wna-Lc*AeۉO6Zg܈*0ig>jtpUy uWYkZa_]6f^=* gbi=po܈x]xtQ3muUb@vbXWjv\.LKwu_@xb4xe'yhRz)j I|mJt)vqXk~r7[`sD_VtaKtd?ugt3vj'/w~l`KxnS zp{fTvtgm^`dinb_vpWe]TqwgJri?#sl3btn1&upEvq ys~yrjghli^tmkSo mnIPpXo$>qp2rrf&ss@tZu x^v>}{qgdogi|p]{k\qS"lsHnbtQ=ou~2qv&hr wNrx} Uw@z}3} pevfg_v\ikwR[k!xGlyE=tn8y27oz&Hp{\kqh{ vD}F||~ogc}eew}\[g}Qi}Ggk>~!=l~b1nD~&-oZp:i umq{{nia@dcӃ[f$QhSFi< h1Xj%kێm5 s<dzDKn{{wQ:d|{U#Zo{XPI|\BE|S_;-|b/}#e# }hJ~pjmulwXc!xQ[Y3x^OyXaDyd:RzegD.zi"{l-[|?nF~5qxkt_au'bdXvdNvg;Cwi9x=k.xxm"yokzOqi|t8yj'qf`rXhWsyjMAtilC8uRn9v4pI.wq"Twsoyxt{wOA{hnxm_ooWV6q1pLrPr9Bs`s8tbt-uZu"6v*ww x zsz|~}lgl5tQ^muUgoGvKpwqB qxJ8)ry#-sy"'tzu{ gyu}b~6fj3z]k{Tm|.K>n|Ap<|7qp}`-Or}"sZ~Ut}~ xh}ehv]jWTl JmA/n聾7p5-$qZ"r4s|i w }'eEg7\}hSjJWl=1@m7No b-pV"q7-r wG|RdeɎ[gώ&SilJk%@l7"n8,o}\"peGqv FvDž(|Zucdʕ3[rfݔRhIj@@nkf6mzX,n̎p"ob\qc ivaR|eBQa[؂&U+RXI\)?S_u5Wb*beu'hMUj߂nwc~X9Z~[mQ~^H~aa>wd04Df)iJkm6qyvb}{1_Y{aP}|/dMG:|sf=|h4}k@)}mj&}og~qt{a;xPeXygOyjF~zk=zm3{o)<{q[ |r|tP~qw|`!ulUWvnNwaoExq2v7< vw32wx1(xOy)xz/z{g|R}|%O^JqyVryMszDt{;uz{2v=|I(v| w}ax~l{x{0S]oaUiq$MrFD_s9 ;lt!L2_t(uvU8wׁz~\nhTo…LpDqY;+r'24sޅ(tuL&v z~M\Mm+TWnL/oԋCpΊz:q߉2r}(ssщ)tovB>Ky4}[l&Sm8KnWCoZ:q}1r((hs,$suDny2]}[݉GQvSWUJ;XA~[8_9/bp%=ebg ކj /oyZWR`ZI@^A1`85c/ Nf$Gi%ۄk{jmhrzY^SQjaIc@xLe7/hZ.!j$0lԂlnQzq.u|2XpdPfH]i?k7m.1n$r|t6N|Wv-|w9$8|xV}ym}z~}Uyw(NlyxFz&x>qzy6zzg-x{${.$'{w{ {|>|~}U2wn}Mx}F0x~>y ~w5yu~-QyG$z9zlr{/}6xTuMTvTEwJ=w5x2-3x$y3yhQz̓e|/ T*tLuEhv&=vu5gw3-w $x.Dx}z+|q`^ASsLtdEu6=_u)5Fv=- v5$ wlRwy~{\QzJU"BX:[2_1)\b_eLg kdrpJzDQ4WIiZB]9`1*c)fYWhukH nRs{P]I`Afc+9fUe1#g(jjYm+l-:n 7qxkv}*O\cHPf<@ņvhx8܆ jy0lv(j]npK+pS>1r p1t\+yI~[NDŽiGk@:Bm8koP0ap(6|r?RtcNu w{~NoGqB?ǂ]r8&s0%u4(vxEwx A{ }MhuUFv?ew7ʀxz/sy_']zMK?{Hŀ$|T N~T#L'zF.{? (|7}/ }'~HT~~~  bPL_}ŀE}ɁA>}7L}/};'}ła} } ~!=~K|sEEJ|>g|7|v/|'|m|@| }^T~0bKr{:D{w>+{6{yJ/m{'{Ԋv{ኾ]{ɉN "|‡(}ƒ}HИQHAܖT:rX{3[+&^# bUe Hgkjr2{[H=/W)AVZh:0{]2Q`_*Hc3"eehRk"7o Pu|G]@_9b2De*gs"ōil1ntr!]w~Fbb@ \e^9fg1֌i*Ik"mpo։q‡)u.yFh?|j84l1nnb*p"~q%stu( xaB|E_n?o8dLq1Lr)t:"~auKw ]x n2{t~Dsu>=t8 v11w4)ۆdx@"~yZjHz{ ~ D:x>Zy7߆ z0i{)ń|h"w}<~,݃$U {2D0D3~&> 3 70ǃZ)"s-܂ NqTCÄ==7gH0)FE"΁l#WɅ 7 wCE5=m.7;;U0a)Ez"瀁d !>͡P8T1읐W*[*#4^`,ady ]gXls|Y>:?V8QY1\*И_#jbTeR1&h PkFov0\}=͚\]7f_1Ya*Qd#fciek (nrT$x~=8Fa7.d;0nf*Oh#gjTl}xo ΍qOuzY{Z1 [{"]|f|iDw~O>{CKpGd K WP KS>Ws0Z"\ievE"(WV\0XӃ"[tw?d!,uO:uz?LnDbHVM^JQK7>ST%1!Wψ/#DZsdGte8藞yw=͖n BubpGdVKJPIZ>YT1MVo#YXcot}b7"y< mA{bF^VlKYJOx4>^SS61qVSq#YtPc;^ tÉ]GL}W^Pp`TdubXWd\K f`L=hc/pjOf [k-i[pkX>|6pbWU`{oZXo[\N\c^_IVabnJcierNCugGԒ\LQUP+'FT: Wx-Z7Z T]nSgav|Q=DqB8AgF?\0J?QO3SES=x:"Vɐ-YH ]#tg/,v;耉bLtd9PiVeT]g6XQh\WEjr` 8l+c{+"mfzni? ztkG~_qY~]U(sY_Xnga[\dc^PeaDgoe8ifg*kj:l5l rna}td|Y ]^q[L_f]b[=_e ObYgCdj7rfl\*-hnujp4 qtq} w"{1TeVpXW{g\e^Zi\Z/\kTN_rm7C2bo 6dfp)fDrVh:s p.t|yyQ7m(oT.ndAW!p Y:Z qlM\rB_t6cbEu3)d3vLfw7 o x\{{xRN/tmQ|ucETvfXdWw:MMZxB]x6`|y)tbwz7eEz vn{z}w-K|+lO|lbjR|WU|LY}4A\+}v5^})e`~-d~Z m=pz0vDISlLFaPWTLEWqwAZZ;5])m_dc%"lyfuGJkjKaNω_VRsKUA,YZ05\S)^bUxkNy tEjI`MRVEQVKT'A X@5[W)].a\k^`_xt[D^'jZH;N`?LUOKS&@WY5Z2)\ &a&(j xDwiLljPak TVlKXwKrm\*@n_3p6c(&qof1xrh wkUrLucTkeX`(g-[BULh^oJCjYa?kd3mgm&9i*ia2kjk%lfmBnFo Gtq~wr[odKh]fS]`hYSbNj]H`dlN=fn31ho%j$q+lr vst~.yq!WkfZmI\]nR=_p7Gb q|5cRS[ UAXRXI Z֎?]6W`,Yb!d͋k;i[ jqm{灤eulMd\uQRxv_THvX~?wd\4x_)xbye{h(~"lud$qTZqWQ6rZGsq]=t]`4 uSc)IvRfwBi]ypk|owbl[Yhm^.P o`FpIc^=q}e3Wrhj(sjntlwn2{"ryaibyXcj{dO.kfEmbhWnggjNiilE4jnA;lfo2rmqf(@oarFpvtIRtCuxy |_eboVdqMfr8Dhsc;wjLt2.ku(*m}vfnwry .w{ ~W^`uvMUbrwM*dtwD5f{xf;hky1j>y(kzm {q|rv~k}-]^[|UB`h|Lb~}pmN6=qn-grp#tr?PtsMxoum{y}W j)n2O k~oFlp>nBr=5os-4pt#rvs+wTwx|z|.VSgtlNi4uQF{jv1>#l?w 5mw- o+x#phyqzu|8y~pUezMg.{ F h{=je{5il|o,m|#n}pL~p>t}xpUcۀMsefEf=h5Bjl/,lj#mo2Ys\x^:2"Tb2M c׆EReQ=^g65#i,j#lv$nL sLwgSETU`Lb EdF]=5f5 g8,iމ#kCm1rw{ bT AMjK͂QCT;S+X92[)Ԃ:_, bZ-Re( _hZQnxR~SJ~VB~Y:~]-2`B)RvcDf.h 6kqzpQ{Z3I{;\A{|_9{b51u|Gd(|gi}bi4~ l! +LoPt{Pw`zI!wbAcxce9MxgL1yi~(zOkhzm?{o ]}r7Jw]}MOtLfHhth@ujy8vclK0w2n(pxo_xqhys# |u}y~NqlGr_n"@Ws4o8}t!q 0turw(QusjvuOwv zx||iNEo2rG;ps?qt8-ru0>s*v(7t-wsuxvFz Vy|%S|~yMmxeFny?oy7p@z_0qi{(&r{s|t} x~#{_NM:kA~%FRlE~?0mX7nO/o( q(rLsʁ wzLiEj>kՄ*7m$/nZ:(oop|rڅ "v@zBTLh@Eijh>j7ikĈ/m1(n{or Rvh =yۃJkMdCQ<T4c9XE,U[$ _$ۇbKψLe0ijoyI8SlBV;`WY3˄]+߄`#cÅ,eihglZr{H}YA*\a:́_+3Fa+x d#}Cgilo|u|G_AC~b :?~dv2f+gh#Ik6mZ/ogrsW|8s}^1t}*ruZ~#-v:.>vހxy zځ|܁DqQ^>q8GrHT1}r*hs߂#8tڃfdu wx2 z!|WDao܆>bpe8p1dq*`r$#Bsgtv ye{키Aڒ.M;DP4zT-aX%*[&^b e܉j_qC{@ R:V<4-Y-x\% _be =h/mm,t |s@-wX:[3^,jaT%s'd fɈiB rl0xtp{`v}?C^u9R^a&3 c,Gf%.hU充jхl osƒx~>d8҃sfx2h,j%l'n$p 傠r&v{>30iu8xk2gmp+ڀo$prm7t%AvJtyv}=~n8)~p2.~r +~s^$~t!vl"wAy|Ȁ~=n|t7|u1|v+|w$|x}Zy}g{?}} !~TD=zy]7zz1z{+z|o${,}C?{~,{B;|zz}JW~m#o rs w{5/Tg0?@AzBuCrDqEqFrGuHzIJKLMNOPQRSTUVWXZ [\!]-^4_;`BaHbOcVd]edfkgrhyijklmnopqrstuvwxy{ |}%~1H?<@0A%BCD EEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abdef%g0hdۣ/Zߪ ;iǯ0Nlɸ ,Os>lśHq̙4WxԘշ 5I[lzy`F+qO, uO)lF!gD!l%m8c , V # g;^0{N"qE  !"#p$G%%&'()j*L+/,,-./012p3\4J586(7889:;<=>?@AB~CoDaETFGGx?R@,AABCDqEMF)GGHIJ|K[L;MMNOPQRuS\TEU0VWWXYZ[\]^_`valbacXdNeEfd(؀+ˀ:JXkeVtA,|〟~׉~ˈҦ~ч~󆧨 [56j_M.Ub@p, w$}ߓ}LВ}=~e~#z~H}~tAi8~T~͆@'~2+|םB|"Υ|/}s}F2}||}h,~S~F?~p+~| |0|INK|gϣ||ݕ{m}+g=}S}Ҍ?!~+l~aW{{P{ӧl{|'w|k*zj|_fo}R}q>}Œ+{~{J޲{Y{j{he{n|y|ae|lR}>}r"+}D{ďa{ȯ{δN{0ˠK{lv{_x| e!|kHQ|ȕ>Y}%1+}mzhz8tz)!zU9{.ŋ{q6w{d|EQP|m>-|ڒ4+}3zB z[gzȉzNzv{;w[{d&{ɣQ |> |+}z*z|ōzNz\z{v{K,c{P{ݞ=|f+|܌(}͆3}a~~].8~GzI8]fERI]>T3*qRۦㆣ2ʴ5zCłЄ2xre"pQ^Ń=h*XUҐٶ"SfmՋ՞ۂlW ^w@d}&P9=&*i]/,̃d~<򰯂Eav"c OЀ<)B顃rƠˆρ!ғus:bBtO.Iv́p*6KOErz`D_M=};U*~щR ИxžB*җG\r',_ My~Z;j~̑<*"~6ҌϓTY@,ݽdu !&q~._H~¡'M1~ ;F~*-~[y4"7ocR6JfI~q~^~L~`o;*~Yp*5~1#v|8s|uӋ2||ۙ9}L}s~n`~M;(e܍ k{6HF. rz_)MRu:y#( !ͱ(B?$D;%'0(q][7^̈́LL^΅X:R(t'<%xuډڧ †ނ"pFӋz]KV'9j(YɄܒԠw7dJ݈9Tbd=oDW]$tK+9e0([^8UgĈue$$M^n\5\p9J9,Ȋ(t ٯF`B +~\Fmm{[ւޔJI*8n(KE-]ֳхͫ[ ֦q~wlփ4[FIד>8́t(5T4-ȸ9F }lNZ;I8Ґ?(< 1݈Ɩd2*^|ԃj5kZHIEBx8~(*l Ǎ>v2|78JkpYꁿJI 8a`?(j{'{{wK{ۡt|'!|~}Dlw}[-~hI~7&儖Guhr`O}WZ0kӉڂZFjH׆7|&ҬlQ߈ۍVH|)jщIBYtvH;z7# &ڃ֐8<o{ *iŠcXfGa6Ԅ&փENϚnW\ӭl݌k׋'yhHX^G4#6I&҅8!𢚫$Dljxz'ˣ#}v:hiVj wAhf/VHߖ{F6&'6~Kc 5JHnԩv\Lme)UE95ۏC'IBa85Y)6֖KMΉwuae\CUBZEf5Ȃ'Y]IQP&}2 td؆T) E&ǘ5k'eы)qzwpzۨ1{>){|0v|f7\}mUI~E59~4ÈBa%/1M sĶәV|sÒ.ue<ӁvTߋpDr4z%@ŕ_Չѥ/ȇte(dYMxT*>D%2%4:C%N/%ȕX!{*sҊcljrSĈC†4ׅ|%[Ą/³Q)|XhnrSbƌNwRQkCKRc3ӆdo%wHe[5M5@ґ20`q*bpR^莴B3W%Æ*P,f/B5ԟ{3pacKQቌBl3%Pg П A-`p)?S`:(Qb=BK53r2%ڂp疱Cn~/oI`Pو&A13MT%򂝉h♙{͖ٓT} UnԦ_`ĠP`)Ae3+&Y˘֖'侠E?|챉m⌭ ^݊}OAhV3s&#J(z[zp{2Ԛ{~b|)o|_B}nPG~A~1ˊr#݀+Pƛ#P}I>>n'p@^⑶GOU@an1䁗#GKd֪ЈӜuus|FNmF䅯^%1O@+1id#цÃwݟ-ӎHeԌ{TYlsX]vN ?Ћos1@T#N7բ((RWRkzbqk܎\ɐ9N?{1"z%$ ɅWŠzDחfQyx({j֒r\$ϐeM0?/V1$<=pcCm͖rKox͚pj'6[rMӐ>-0$fćiCo^ϫƕueQcwٔkipƛ[ L>׏09 $^D/meEǔ`I ~$+vJhZ]؛ML95>b 0І獀$+f Hғl6wv!gJ!G0$‰GWסtܒ(ƒޖ紁uyhgcOYYi)K{›=0m$ԃ%ƭz.=z{{uG|g|YA^}lK~#<~.",r߮_S &tfϙ0XʁJn;<l.Ռ"PςHY ,/8:^t f2XBJACaSUG:o.^X#׉ƴz(zLjN|{z{mb|`E|S}zFr~?9o,Q ݊#&jlk̀z[lŢ)_REՁ/8ҁu,F! 5HƳex2xyTl)=_:lR:WcETG 8E,<{!0U=D ߩv6xk^QȘևEɆ8Dž,4!RJ$ewפj٠tJ^dQTY$DN8ZI,6x!}? 8ow&j.]PdDb،>82Ί",A!·,7yUˬˠ4vmʙi]?P~Dr8d,Jxz" ^YO%çguzhMO\,PCԓ@7,N":t2iN맸t5hG[ћOC7,L"dLDZI+t9g[hO7pC6h{~l{qì|1eY)|Y2_}WM ~A~5MC)ǀg:f\Êwm}G+q1>dާoXʢLH@ǙC5))ƐދwIaҵ͇x}/pdgȅLXd LbX|@05 )ˏy ܃pں܉(,`|p%c3W{L·@S!4u)ώ 4LS;48{[GodlcmWJKD@T4֒)Z r5^Դ'{Dtnb%W!hKh?4Ò_)ć E:˞z}nj}boVAKH?4狈*D!˓M "z&m٩aOVZJҚۓ~?1X4z<*&ҊF*M;Ec1߉'ъ~ ؝,r7MfGx[הPf]E;w1X( }vWqĴufKқ[0\{PptE͞w;sD1݌(,x Y53Yh}qFeӮbZ̨P$nE ;`Α1l(I |άpس.ejZsOEss;Pjh1 m(b U>|+^p~neqZ,1O(EQa;C1(ui9 ڈsZ~v0}jr}` }U~BKg~ATdi76.%Bdfu jl_޹&U`K5A0.7ueg.&*%;׍ɂ΁9˂u;jx#_TQU:&K=Aτ7i.,q_%[7)̏#uEmjg؋_U-t|K BA%7d.1͆ %w*Ere u`È|j1{_r厱U"J@pO7bS.C%VŅ$Wu ܗQiݼs_%2TǰJéЎ@飹7c._m6%4pڀ2͟ tN i^ⵗ^TgJ/w@֣$7d.xՊ&iAwPGtsˠiMVD^T]җJ}9@Ȣk7kv.J&GN֩Mt2MSiѡq^YuT&?MJ]@7zp.ˍ>&t#qok)shź_i^2SKJA@~7{ .Օ_c&A@sh ]곗USѭ\J+#@7f. Y&o |zo|z̑}3{i\}| )}|~ }/{~K}gn~~*S,~~>~*(~{,x{o{ta|k`|ǂg}zX}lJfB}ł R:~>L~dp*~5yOAzrYzC{b{͈ڌ|4y|e/}Qa}x=}܃*\~;;yTyg}z zsz{f=w{xd4|gP|=4}a*&}׃lxE؋xΞAyJ"y!z5j>zv{M*cQ{܍O|i<|\*}rhwTx(3xy(NRyƉz@HuzՔb{nyOl|<|*(}VwՅwx'ex|,y<yНtzm}a{ +_yȤ!Mz_;{'*`{ދ眃tx؂yvz+9zқ{ˁ|?ur|bAI}O~?;ހ~)lẃ< D#;큊ZtLsa1dN/xN;SY (5eڋȀ!Fvh$l醹s!`8"MnN:փh(Ăk t{S'6?2r9Y_SILW::g`(`EmVw~ј=~~z~/p~^~ŌL,~݊2:~(~)6~˹~y@~HA~"ޔ~Y~zp~5`]~XGK~u!9~(~ܮ~FF~K}Ч奎}f}_}o>}ϗ]%}K=~9~1(~/F}}}pa}MW}JՀq}Qn{}rB\}J}9m}ߍ(}}%ǯ}pHj})v:}L| }}m}\ }E9J}i9C}(}}cƝ}=ڴ_|Q=|̸ϐf|²d~|m|֥b[|J?}9 }P(}h }xղž}i|q|Ǐ|~~|l|[9|J|ݚu9}(}'*zє+TٯGpo痄{_Rj!ޑXx Gہ 17T'E;$᭼ۤp[{Fzo虡i[zXL|Gw6:D']h̅ij~;NWyhPWGW6'qMt͊>yb-D81sUZѩ x:gʞW:juFĀ%6'_^GAD44=7wgSVǀ!Fz6vVx'~ʊ&VOhXwЁ^wYfրGVkF>6Z!'~͍vwlA#x=^yIyyzh{Wj|F6}b5 ~:%B˶`)],YNjSuwxy$gVƀEE5]}t%Id}ȇHRUȉwXtfM U1Em5%҂QRȧC;ɆvP҉ZeΆ-UFD񄘅4Ӄ%icƸöoeBlquIG8d5WT-tD~"4%Ɓ8u+i-LFtIӓ d!ŐtSD>4r%uՍ `w"KŞGslnclcuSv`"CT4NE& ˆ汯eR\Iѩ 6pĂO=rb }R fChJ4(E&Oº.'.-TWqɡbRiC4&.`/bܠZB+zpYalyQvB‚j3ށ^m&> 5pЯ5ĖD/Af̷ɆjpcU`BfQ?B2%3)&KSyJuv̡\gwPxʐPysr!Vzgb6y{LR>|0Bm}2.~#fO8~@B~TÓ~i~~~q aFQQAK2zB$׀:Uʔ慫_ ΐsU߄o`o>PP݉A}Â2IP$,X^^r!񋳍f~O2QogO_HPI>AI92B$FH@`y^ԑ]^|nd}Bn0ތ^,CO@҇114$gjC8OO|70mIm^4+O*@baf1؄$䅸wcsJ.{Q͙l ]\N@1P$q˶KĭI~HQGLzizOk\N5[?Dž*1}$̂5ߦ*MS+9#yv7jk,\AM?qY1| $䁽-ȥ)"3rMܮ$xj/-[yeM@͙?&1]cn$yG@aŲQkwԮi[/EL㆙>ᕏ1C.%Cڴuvwxy^Hykjzb[O{PM |A>_}A/ԉ[~R"l}$}ԕ~ ~/xF~xiϒ~[ 'LrM=/€["v8ۅ6؛͔b݄ZƖPwH߃hr7//#{tt'HQ퓯r>Qd{؝#VʌI9?;c/C#$5R  y qVAcՎ^VCEeHՉ_;b/Z#݈רI+H󻰌Q7~fNpԪcO`XU֌ H™;m!.!#ς\㨟u?vw~xjpyYcrpzUUX{OGL|P:qN}b-~!覱}-}dt=}}}p~*b~U~Gi:+-߀v!7,kpu|ΜB6oO-bTGp9S,MH!dgV>ꋁCtɉ{naUS+Fb9,̃!eaΡv?{ m` SsFS O9,F!Qu)󙭔ҡR~֕kz'/l&_-R둎+E򎗋'9J-,Q!{{6yb5WlK%_m Rv(yE195A,M",@|3 ~(+pu1}1$;}cx.q}l<}`~3U ~Iy%> c2C((ڊUKha[wk(` ȂTgiI,^=ٖ]2fd(;8r-v߫Sk(r}_TB*Ho= 2ёЄh(KJhb v8NjԌ=_|Sٞ$H׈=y2‘@'}4J~,d#ˀzq~p ~ey~[0~QCGl>1G4i~,-#Ȓuzooe3Z[ނQ.GB>)s4,?#-1z7yGoo#dZFQ";Gi>&|4ޅ,P$3myıo(ǎ9d쌼Z0iPpAG}->%5"&,iP+$R8ׄcy n" dsAZp|EPGP!>+5n+,$ˆW$ymÃ=nd8AZ-P}G*E=򠍌5 ҋ,"$ď1UfyAndEc"_YLPGG=65C,”vy$󎪈= Kxˆ nc}YBPDF$]=ٟpu5,%2ވx|mռ*cr#dYl>Ow=Fɤ=ў5)I),%Bω F$x2mJc?ĤY<٠OFJ=ʞH52쑂-1%_c.syzuyv òz|wkzwٝ#{bx؉{yvx|[zc|{O}i|nz}u6{ja| N|;}<) }v(ҿw w͇xw8y'yڄt zY`{GM{;4|S(}Qt咈uؐvӫ"wp(hx8yNryЈ` zMM{]:|(|t tSBuؖv9wvxTqy-_6zaLz։':i{(|rtsdydtTu6vFv8awƕ4px7^wy7L-zg-:'{?2(| ޝrήsctnuyQv^pfwIpx6]y Kz9zM({)4rdtʝsU\t:Su gwu򤴁pvoRwϛY]=d(~TOD 4~&+~ ܤoBSt_~כd7~ŗT~D3~4~&A~VʀGóӣL[~(Z~ps~zc~gS~b$C~UG4~Ay&S~ µ(ˢ Un~~bCr~+b~ S~mC~4_} &a}щIıUó~Խ~i-~$r8}ꪄbv}դR}ѝkCZ}ɖ4E}Őb&m}vq=sOЊtuvtx,d7y[SʅzC{3m|$6~9zTzۋ {{{,|msZ}c7}S~B~3.L$Tm/ʡÂuρrFbRRPQBn2āG$o(td'UvJՆ oqR3asQB*2ÂJT$vNͮ)7.<-:~fpUx`Q7oA2х`$ż Pⅷ~coW5_mPy‹AN2q[\$ŀJ&^A=ЌÅD}un|_5O]@2P2$3XN"zݤ|/mP^Ot8@P2-$8'w̅{lڂe]߂JN񁦕z@Q2H%qbԅKE[zۃpDl'#]KNZ@>1 % 1ܵEĞ* N jz33ki\ԁN%`?ʀt>1̏N%.~{ɕqb(rĚXt=1uD|2vmDw^by Nz??i{0|"~Myz*ΐzӎF{)z{l/|n]} N4}?~L0lh~"ۃŴOȁrZDcyҋ߁k8b \UMj>10J݁ #v!ڑ*هuxڋIj`[XLM>h0,b#-`mq.+ӍmLwӊi}EZ̈L[~>-;0#UV;ӎ ovNJhZ2UKӆ =/h#}ٮ񠔎GbKuu߉gш;)YK^=wO#/݂#פּl8KECt6gڗX􆎔;JE=,t/‚1#$欃oiYd6SO1t.fM)XR6Jk<ك/K#Ԁчr;XuGׁ< sW[e6Wƅ뛽I~>:yyzU铹zr{e=w|{ݐn/aqT&QF̌: f-z"[OoqˢlJdQz*mɎ)`Ȍ6SQFm9͆-i"~p(N~z١lԝ`ݚ3S bF9(-R@"4f񓍔PچsܫyK$lJ_YREɕ29Gސ-]Ő߄wjM]P3Pѐ]C7sy+1 Wr/ԏ͆_Ņv@;iE] _PR Czz7J+4{ Jꎇ%݂!u_Mhʔ\cOϏ}tCLc7b`+5z ąe”ʍ, |t}͏h([OLBq56+6c ̈́T:o58%s]gZ[/]Nێ B6p+7쇘!/K㟴\ݜrfVZ>Ng.bBL6 +1!Y݆cȩQ›~zr'eZ_:MҔAE&6W+$&H!|4iH}VQqrf/eY"Y|M{A6#aq+ًm!4\ۉH7b}$p/dْy\YӟM!CAW5"+ c!%}qS|r|ksp=yud2vdXXwL4"y"@z4Cw{(_}E;}xGx{youz3czW˜{KÕW|?͒}x4*~^(ыY鈅wv*7z8DnRbڛLW6KZ?SW4(-ہyم _yӡlmgb<V@Jq?P4y(fhGs]xŠwm@?la숆V(Jb?#3)τG}בvx0ɏ}3nj_)< çubMw~Ǖ$k@`nU1IВf>)3)") "m妫ՂR%vƟfqk?ڗ_ݘ)T9Iq >Kh3})'No R )p9vj_@(sT5ٖWI=_3^)#쉠 žV4ʢuQإ&i:U^۝SHI= "35ʎQ) [Sŀ*NtĞ2il^E|SbF&H]=ʔ%3)X ‰Iiq~s.rתetmg8u\d)vQ}x@Fb y;['z04|n&Zc}}Dx}xy-rCoyfNzt[J{8QI|FP|;1X}0e~&҉΀H|#q>forN[swPEϘ#; w0&>eO|pe裟#[PTEԃR:0 &A^{Q{KBpNeTZO AEB-n:N0k&ދ3ԃ zOoldV]YfOyDe: 0Ն&,y1od5ՑYO+D2:k: _0ku'5 Nx.mMآubX.dN —Cݔ`90WM'=AjMPwlۤb5cW֜iMŘzC90Gӎ'CЅ'g~sZrssiwu_>v+TƧwmJТx@;z%6֙{-R|$'N~Q{~*-xs yi+z4^RzT{J|^@`}<6ɘ~!-a $\q؊}s- 3hN^el]TBJd.@xD6急-o= $m*8},rh]/c^S냰J1Ny@WC6'-{$q|Xr7L,gfP]fS&I@,(6tm-߄$S%⃠|*qQg^Í]0SBNI?]6҇-:}%h2q{)q4Xf6{\ƧRI_Y(?љЋq6}E-%7T'{pRfv\^RrVIؐ+?P6kŋ-,%WzKp::GfI[򦏘R9Hםb5?wڐw6UN- %q'Kz Moïߣ"e['|Qꡐ?H?Nv6Bꏄ-SZ%ɉX]y|oXeF[IӠ QKiF_b0V L֪CH];62}*`"sHiމ_DzUѯ'Lχ5C٤i;2?*_"߃rh&}^ UzlLfCw:_\2 D*7#6J<>(ar<ەhH| ^&U0ˏZL+uC8:2n*Ɠ #k>qq茥r䠾{t'j_ukpY8vEHBw7y/'zbr m1=npq7鋗rxzsiuXvFGw7Wxݍ'z!vlfpnVopܲۊrysaUhtzXۅL0## P8̕ۂއK*xjQJY[M>b0 #8V':ẃ3biϑ[nLC>Ri0j#2a Ђ1q.4*vh`Z]NL ݐ>0KC#~Նhׂ`۪ʒqS0ʢu_g7YDK|C=9=0'~H$~N!l|Ozu7 qgIY,cK)F=f~v0~$~FDYEȴ&9tʩfd!XJ~=+~k/~k$"~lΡ:n,pX׌qvshRsu/Yƈ:vK'xQ{ͧRG|s8nƅoavTjtG7:\׎-܀|"'z5]W${0(n "a&iSDF΂j:%-"~N?z_mur`rS{PFz(9܁H-k"pDclnpbp^| lqnsazuxo8z+{ n}ۖ~tc$Ju68vzYwmx`yS@ zEډy{8|+P} W X>{ϓ%|e+|y܏^}%lȍ}_؋~RZ~pEm~83[+ ,p75u+-ʐ=xՎ{kт_-[R -E 8S+) ԃ`1`{-wЍ=ko^VQuD8F+ۄ! Ҝmɐ/vҍ-j"?]P߈wD4 7ޅ+фJ!;K6Beuib\P] C؆7 +Ƀ!d 8Ӡ!ٝu=Rh\VOۇYCw47n+;c!ߙ7=;t?gI}[4ORFC ֐o7(\+!J97F =ύXs|g7/[!j=Nۆ,B 6 +!MO4A rߋT.fZ(N{6BdCc6ː+~U!рLJ֗ޟRlݜrnpNsG!qfꔨsZ6ufxOZLynMzAA{51|)lg~JaN{{}|-qp|eP} Y[r}M"5~@~5>)~Zł h$|p9d큷XLy@X48)+QYr{ۇo~cȑ9aXL*ׅ#@T|4҈)U؄ؑ<цQzExnҒ"c WtpKP?9I4) f9y͔“ ne#bi+VVKBۋ?ĉ4%)t BaՏ_F}КxSmY&aďV`bJӋp?cZ4R< ) k񅦏 z*xIlAaXGU΍'KJ[ :?4ی) ["->wRkߑB<`}UNҙ I񊺕Q>3ㆉ)~pA EOh !vokP`T挍Iu>qc3GW)s/5 oŦlがnv<5p@jÜq__sT)uBHv=x1zo&,|Lw~Vťs€Atup ujv^xSyBH;zl<ߏ{1ۍ|'&b~,臮az1{ t {iJ{^|S}3Gܒ}<6~y1Ԍa+'I:ȉi~= sh]uR'G|O'1!'r(Dž‚݇Ҏ|njr g\9ˉQ䈫F;U1'لׇ L`|1@q[5f-a[GQe>Fd;njډ1'V>)暠{fјxpJeޗ[)ёPF -;kz1jY'TlsVzx9oܚ_e-NZh&P-vEƐ;:1%ч0wMn'mocqPY訉rPJ=tmFv%=vw4 ~y+0B{d" }|~wtAm.OuWcavcYw_P@xFy=Zz4|=+OM}"ߎ"~ v~zRl1zb{oYA{O¢K|F}>=<}4~+kt#RMIWu벼;l.-\bqX᥋uOuWFQ=4؁2+q#QubІ kKbQXwO~FL/<04+J#tk(a4XNŸ׈'E˛_<̗4s+T #7Xk2m񆝬wr`ysɄ+hu7WvFx~6y&z>jflnio(qpxrgtr8VuFPwy5x.&&zrʌjƹkߗ]m ro-݇pwwrKfsڌVHukEv5xk&CziIոLklݜ8npvqfsUUt@Exv^5ex&[yeǁhضjy|l<mZouq3earؕ{U't|Ev&5=w{&pyWGh-i-Tkm_+o tp_dr`Tt yDu5wj`&yvsuokcqISsZDTu4v菊&x0$xcixkרy=myo݇zIqw zsf^{quSU|wE|x4g}zh$~L|2v3s0vtVwuvjx2vxwuyxeTzWyT{&zDk{{4||$}}tU|du(| u|v}6w}txu}dbyZ~QTzH~C{63|?$}rۅC/s˄^t9nu҃{vuswcx|SaygCkz3{$|q!pr͡stoBuXrvBbw/Rx؆By3fz$|qopدq̔KrstqvHaw&}RxLByo3:z%{ٽosvq r'珊s;QtUpuq6avQwэB3x3z%{8oO+plqqrsÚ|ot+`mv Qw^Ax)2y‰%7z;Qnװooq\^rT~!sANotj<_u&PvAx02yl%Jz89nh oyMprq}MrҦnNs._.u@GPvLAKwؒ@2y#2%[zaFn o p1qN|rxms^tOv>IAwj2x莔%gz2l~i.b~k^'~mt~o`~qCp~s(`~tPvAI?x1zT#|;~|r |sTw|t }u~}Avoi}px_}yHP:~z|@~t{1~|#?5}v{ z{A{!{{{|}i||~nV|d}^|}O}E~@Z}~1T~.~#d~kyMy6zY?zh|B{2m\{^.{N|?}}1+},#~'׵xΧex˘y[ȉy͈{zAlcz]c{H N]{>?|Q1}P#}?_wx S^xyzyZksz \z=M{[?5| 0|^#}.v̜BwNؖ*wҗpxY yxjyw|[z&9MIz>{0|2E#|ńұv9qYv\w6Gw›3x'xW4ix5[Ry8Lzn3>{*"0{҉$|kduĬ(v7v4wCww:wڝixu Zy3MLSz>DzŎ0{z$| ٯGu]uΰ_vJvاvmwpzm0d{0K$*{⇧Qu".-"z1|~s~U~s~_(r~Te=~MoW[~dI~~;~D.~"~_}M}՗93}Ǖ }q}dz}V}I ~;~0.~A"~A}[y}G`}8~}2q"}: c}EhV%}mH};W}Nj.e}߈Z"}ㅕ|񨺘X|٥ |Ȣ5}|ÞpG|˛hc|ؗU}H}6; }cw.F}"}~|]U||m||go|obd|{pU|:G|ۓ:} .*}:h#}SC|Nz|5[|#|%|Bn|$xa|/T|ZGf|:|Ƒ.|#};th=+$jul~[npȇpcPrUztvG.va9_xT,|zD E|ipiqيs5}*troubgw TxvGYy9{),y|| E}(x2--x4By{nzBnza{T=|lF}(9h},vT~ ځ^p݆(zЅfm#`BSnfZF+݀o91S,tȀ!7܆ՇF>zylޅJ_݃7RƂ!Ke?܅\xًtkƃ:J_&R $E=8=,Wc!v(52Lq˄Ow>j0^^fQDՁ>8jʇ,GH!R܏|L] vƂj,/]Q7*Dlь8(`$,3⇵!PNJ8IEu߂V-idə] @PzђCk7],9!~+LLi`uht\x,PzICV7g+9!~ރ ob?tth).\O3vCN̔7ea/+~!~~h6ۑ~jluniBp\rO݉tBVv6Qx)z넛|ƙ|oڍqucFrt݌t;hYru[wOCxeB|y6$<{8*|D~<Zw51x0*y sԋygugz[8{XN|'B.|5}*i~I)~㍃~~ rȊ:fokZz-N$ Aօ5؄J*ԀՂ͕M"ĉ}ы1qƉۄeLYjMXAvV5O*!BY .WrЋ|hpԉ-dއ Y ӈMɇAˆ5sŅ* C*댨ˇl*m{ЉʐpDd(pXrOLLy@R5DM?*= n2݌ ̆nzFo5cuLW܅ِLڍ@b㋖5 Y* ҇0 Ջo>=yۜnabWCp-KsE?|S4̂|h)s [֋`䥉y']mMb 0VK'?%4&H)$ ʀLÉx~=maVTϛJ΃ӗw?aݓ'4b)؀ ևݚhR6jy)lmxnaʑpV@}rJXt>lv2Ӊx'z2}oqx4urlosaqu^UtvIߌxJ>%y2{E'$| o~^vVvww&NxekUy-`Fgz T{zIk{=|2!}'̆p~`nj'}Y0X}v=~j̐T~T_~p~TZHY=$2x'Ҁv.8huYi{}^@SɃ H=X|2قZ'7-탓NJ.t,kï^ S$/H )= Y2`H(&!!z~/=s`hl3z]rmRG[<Ňm2@ˆ(!NWr}JBrdgh\׋tR!1G?[&Q$fFn͒;Ն:p11'S<=dDzҐ^pYhdeƌ[/Ν Pʼn`Fz;1W'䂹ׁ$'hxzjp.leEbnZpOrE Zt:v/Px%O{}s2oKyɝpoFr5d(sYu%OyvD[x59y/n{Z%}~ă*=uxќjvnfwcٗxYRzyNzD[n{9ʍ|/}%Z~O|]w՛M|m}c }xX}Ns~jD~9AZ/%܇mz v]lbW0WX CM*9CԂ%9n/K% Ղ@A)v{ka|WyMxCI:N95/~&m(0\^uL,k9[aދVoMvBM9t$/m-&!^~}xtkjВ`RaVx鎮LBlUiKǍAn8=7.,& kӂt| ħorF0M~5\R,h#׉|)wm!dTсZQ@H}>5e,$˂%vףmAXWcZ4;P͖텺GօB>b5FJ,$&#j@Ovlc/oY^PkSGWE>+W5*r,$D{uU|8kbېYYDʎPōEG=֊?5,@$X=tkSbSX>O?FA =^4Ռ~,o$b؃ԅ.tuYjauߙXDǗ6O.̔FY֒&=j4,X4D$iK}sTj(aWfNݔoF=74ʎ,Fz$n8p)igCk]mT֤okK٠qnCs:;u1zWw)"y!"{*~ pof˫nq][rTsKuzBw:%x1Kz^)N| !t}>;oIufM(v]-,wT%hxuKLy{Bz: {1V|)v~!0wpMnԭ%{de {\|{S\|J}|B~~9~1sU)!*҇Dn<,2e-D\4&NSQsKJ\B@y9ΕB1) "3n&/mLdCL[^RퟰfJRB59H1)̍["eJqP m d5([]IRWJ TxAЗ91c)ą3"#pl2cZR>e=IšA 9koG1wه)<"}2nl"P`cDOZpQܝő*Iq#[AX~9@ꋾ1`W)닿&"Lj'sĄk{bΤÙ^Z-Q:I*A Y9x1K鋭)Ul"هŇG;jrk1pbbKYȠyQ?ɘIH6@󕦒81:0)"uX"fj]=l1TmLYLoDOq<|}4'~-W&9 2Ѐ^dϴ \4SΫ3K̀CܢHL-Ӂ&h w`9d})[鮾PSVKr|C{5Bku/3w$x :cɮfd2hhj9lpn`p%QfrBt^2v$x`c,DeBgTj ~lon'`Gp1nPr:IAtB2vG%xHbBeMgV[Nior~knm_oPyq’As؎2u%2xaګd}8fӭoh}>kXn:m _!onu{_;w{OxX|@uy}41Uz}#E|~gnopr<|s mtƀ^lv%O w|-@ xڀ*1$z0 #\{l"n9\o4zq{r{lsۅ-]uINv?x30yH#{f=ke/m*nˎ<7p8zqqzks\tMv#X?Jw0yl#zճjwDlEhm;omy{pjrs\3tMuu>w,0xf#z-nikm7>nhxpIj.qړ[sxMu>v+0xME#yׅC3i%[jԔ|lMn%woAinqNZrLtu>pvP0w$ yD(hjltl@:m vo;hp֝wZwrL3t>>8u&0~w$!ySPh2С ikm> vRn֧ hCpsZ r(Ksꗉ> u@0mwm$2y$ҳzdKn{g{Ti@{ky~{n'j|Bpe[|rL}>t=}v/?~]x!{x^m!xnXykpyr&x'zpsizuGZ{vL|;xd=}|y/}{L!~O|ͯv[uwvwwLx{xhvyyGhyz-Zz{K{{Q{=||.|}"}~]t~7%u~h,vy~w;~uw~gxY[yUJz<{h.|F"*}'άCsXt]uPv(tvzfwׄXxʃJfyʃ uEsv.ewWxIy/h<z93.{3"|&Fq3rjȎHs怓t{ruu%e3vrPWNw{Ilx;y.z…"{ܨpq2rЙsϖqtӔud{uۑVvcHx*;yN5.~z^"{apq%y#r;N~s>q"tGcuSV'v}]Hw ;Sx䌪.gzL"{orp:q}rƣ pisџ%c(tߛ2Uv+H7wO;x.Ty#zֆop=~q[P}$rcosp%bttUDuGv:x?.Dyz#ziPcBf€i.kr1qmd{LpVjArQHJDt:hMv,€bx N{2lUn5Go~qps*cwtU.voGOx :ty,{- |ҥ}t}\u}v}Z}wo}xb}yT~.zG7~n{9~|,~}` 9~Sd{|p{|d|;}P|,|r}n|}a|~CT;}>~F}~9~:,~Zu!~z=yz={{{hm{;`|S|sFH|E9L}`,}ȁ!<~*?y yDz8XyzSlz_`{SoR{φxE|U|9|ӄz,}Cu!l}kx=̒RxEymxy׏l zEi_NzRS{>0Eb{Ј8|Y,t|υB!}8wk/x5Axėwy7kAyw^z*3QzD{V8{=,c|i!|ڄw"w8x>owxj{y1]yQBzFDz厠8D{~,N| !|vV3w@wϣvVxG.ixǜ]pyHPyED=z}8 {#,;{!|H`v?hv‚wuuw陋iHxpP\xPryCz57zُ,,{0"|T"c MfbhwkAjm^$soQr-Cփ^tk6v*Twx{bkÏlm9omvTqiփr]@PtsPSv#Capw6 y*^{+Z_|4st߃quugvh܂w\n8xOzB{&6G|=*g}F~b{'s{$|"tR|gv|[&}|O }B~e6b~*njA8sSFeos>ǂ6gZFN&B16-e*mց3 "W֊P9~75r5fʆZ"8MqA|5j*eK U"Jq#}1tqOIeT%Yy_Mg~Af~5~!*_~Ԅ ~lK~ژ]~ߖ|;~Ԕpv~d~X~~L~|{A ~h5~|Y*S~j] ~ImE~Jc~Z{M~Vo~5c~iXI~ Lp~ @~I5F~*B~ }MA}a}z}n}ϝ^cL} W}L}n@W}5}*1}3 } N}X$}y}3n`}{mb}jWd}\K}^@}f_4}mI*$}|T }xcŇ7f{{i ok^cmW刌pK|rV?t{t3v'yD˃{ȑ(kHꋭmRzso6nvpbшmrW#ht`Ksv?w3my({a'}DLr1sy?%uAm,vXa=w{VlRxJxy>Ʉ{3R|4(+}`xX~TyكOzx{Cl{a |UUE|J}>~~3:&~(?u>ߍ*wс;k'`M2$Ug)I#>*"3(Kف.Ѐˇzujȅ6`_wTi9I=т2e(OG7I̎u>j}^كҊPS؃"%H=2Ál(RɄkhV u~\t8di@쐚^5CSPH7A=7l2(OZC%~ؚ7s]hj]ƓoR̂&Gˁ<2c(EKX*}/kPrg݂]^RZÔGn;<240(:˩F|v1rYgX\ Qr_G#씡<_k2(2c~ԆM c}ifrigPkc\mQp#Fw:rs;/t0G$w%%yW|+k|OGmqnfĎp[܍LrjQt?F(v :w0@:y%{ }oq{ sUp7te捧u[!wPxOE)y:z09h|(&}xa~܄K0xz yozLe}zZb{O鉍|YE/8} :}03~z&/n:4xnnd1Y*OVWDÇlz:D90!&Gɀ񂕁.wmˌlcmYXNˇ1DZŃ:X0h&W//I'swmXbĊXvNTaD39ƅ/&edsB~v:lE%bcWM؋C9q/̓j&j7u2uc`k~.asړ}WZlMm]UCH;(9? /&gІ~UxOtjщ`߈g1V߇+M Bؐ8E/z&bzրUy}msjF``g V{ҙgL)B8̃oO/ZR&^5},dsߚfiHi _͕kbUmKđ0p6Apr7t-4wb#y||mjr li+n_{p[U=r7KItAu6w-Cy#{ }{qYrrhKlt^f;uDTvJΎw@ΌyU6݊z-P|#$}g'zwqXxgj/yZ]zSߏzJL{@z|6}t-\~S$IE;.yd~.p"=~pf!~\~SH:Iӌ@&6<&-[hy$mׁBxXVoLMeߒE\Q@RŽ>fIf<5?׊a6c-PƂ$cD2Iwŕene=[Ǐ*ROkI?ʅ6;*-F:p$j}0vݐ[mҒ܏-dލ[<䌰QڌkH &?KB6 -2?$/v>N1mMcMZQCQ_kzHH>ȋ5ч -J$<ց˄ulg˚cLԗZ$ՕPZG>`5,鉏$+Dy:tɓ,kБX bϏqsYpPGŔ> 5qV,ڄ$ 7sidjk@g a+0iyWכCkN\n'Exp<7r2uh* Cw!zW|rǢjil`nWSpN'r_E5FtN<v;2x0*@;z,!|#$)~!q-qh?r_esVĘu,MvDݓ(w;ѐyf2z*\P|Y"4}_Hq/wh5x_7.xV*yM6zD|{;|2Ӎ}q*u~e"jZׅRpN}.gt}^"~U~ZL“~D#0);`27*f"O&To~fĚ]EU!L[CԐr;,w2`*P"GmRInÜ߈f)*"]TLa]Cͅ:Y32*"n$)ev?\Ռ@TFG&KCI7:Όʇ2}d*"ރBmdגV\l5Sϓ_KG'B;:E2Y*~P#  لzl dkIG[iSgfJ񐥑YB4G:cԍ27v*y#-lG]Scϛ[?SJזs{m64|o/}v'~} {sgG-|T^|V\}eNw }Ff~I>~6ȒNL/''ތY cef1^zɁVNvNCF >o6/#k 'J!!1/RIfH^ U󝮆GMњELV>D6焂/&Ʉ(!N[ey']/hUM̉E>m6N/!3(%:!r l&7e/ő?]){U)?M+E_*=ӊ6`n/(,!gTʄPd!=\ݔT̛Lޘ}.E"fb=O6A>/.(/$!-?yqd' \UXT&LDF= 6)ٍ.̋L(2ȉ !܆*/_jeWigOj!Gѧdlb@Z"n93qK2s+wva$fKx{;R}z_EkW@m#OanGp@Fr91t2fv+*>x$zt |W~^yqVrAO s~Gt@,v[9(^w2=y+M"{5$|ƌ~G|^} vVFwRNۧix)GMoy@Vz%9/{62$ |T+i}y%$~ AW^ {VB"|7NI|GY}/?I}9+~]2*)+3%HHMStu]ԬV!N`QFl?h8VF21Y|+g%{BI]UϨ:FN.zF|?88ꘝ27+%׃^̉)A]NUaMFՇ?O8ח27+Ґ]%Ɍ;~!{\;.U@MٌF`?^)k8AY2.Z<+܏w%䋨 !)\TݒM#`F4S?n }^pI~8Nrr~{?t~0v~#x~`Յ]cטf$Yhy{jălFm ]:oSN/q9?\sށ0v)#Ax[+_Y-JbBӗzdghfyi͉FkUl0$\znMp?sC0uc#xw ^.Ťa&ra0u#r#we-];L`:c䆟eAx"h2ij[=mAeLo>rA0te#w7\vƢ_|hbW dwLgcij ZlL\oA6>Lqӌ0tte@#v򅫰[ɰ^۬;ad`vfhxiZ9l6L nԓy> qu20ht$ v)[2A^TaC̄6cvfCgi,]YkћkKn{h=q*[0_sߌQ$"vQpm_qbere㈉shytkIjum[w2pULx|r=yu=/={&w!|yﲑmyi3nk3p[mBqovL:;{Jx/,|Ry ~}f{æ$qxp֘rr,ss|~ttpuvc vwPUBxxGry9y9zj{,{|3 |}Ymoy,Wpyˊ*r'zg|sYzovt{b.u|1Tv|FxN}b9y},z~] |%~Тm[o`Opʁ={r#nrsbaTtSvF{w9\x퀵,zD!{ElzB]n"ozqmyrtY`sمSCuSFvׄ(9xS_,}y!J{kQ#mnnTyp)lq_s%RtEv@R8wͅ,tyDl!zzjnl3hmޔxodkp쐶_)rwR0tE>ut8wTP,jxۆ1!zVi̠kpm3hwnkpP^q@QsuDu;8rv劻,_x!z i9Ejlw n:yjvoΛ^qcQIs'DtА8Fv,Ux1\!y˅ޛhNj{قl2vqmˣioc]pPrDZty68"v;,Mw!ym|_\}bm}5e\y}Vhk}j_ }mdQ~oDY~ar7E~u*2wz,zOg1zi愉{7l w{n j{p ^|]rP|t C}Pv7}w*~\yP~{қxoxq8 ytrvnysizuY].{vPK{xCf|Tyv6|z*}| ~D}YJv?wwx{wy>uWxyhy5z\ky{iOz|!C{m|6|6}*|~}~touvt>wVgx[x߀OyBz$6g{,*|W) }"&0s\Et~Hus*v`wfw:ZxnN~yB)yN6+z삷*|{ʂ C|rFgs{V~7t7r;uf&vtZ/wcMxcAyiO5zf*x{Q u|/qk׈r(}>s˒jq`tːejuɎYvƍM{wҋ)AqxI5yj*qz慗 {Ѓ̓pŝ)r|Us*pt2@du8Yv=aM wQAxjH5y~*gz/ {p8e'qz{rosd(tXu˕Lv\@x5dy *]z9 {>omqzr9oYsKct\9X+unpL[v@w5Axԍ*Uy { ._@zf)g"ih{ހkomcoX!qKys?lu3ހew(Rmy.z{Rn҆5p`zFqnCsNcHtWZQv;K]`w?cuy&3z(f{}}r}Vv\}wHyh}x)m}xb4}yV~zJ~P{?~|_3~}1(w}8~Ȏ{}s|*~x?|t~Zl|~aX|~U}JU}lS>}3y~(~d~-z{΂/{w{rPk{`{| U@|VLI|>Z} 3H}&(}Ӂ@~jyv z vz0jz:_{MKT{\IJ|a>|b3|h(}Vxs}xyCu0y͐j.z=_zT{nH{=| 32|(|}BwxtYy2ity^tzSzHu{S=h{2|(|||zwp~IxAsxhy+]yVS,z&Hz=%{.2{(u|5|:wW}wTsxI7hYxƝ]yJRyΗ,GzTQ*z;F{-;5|0T}&p~~ڂ|5z|pA }@e}Z}}Po.~gE~:0w&h.=ybo@!dƀジZ9OӀfdE0A/:%0q&Ё8sxnna@zdYOM;Ds:^0Tx&N.nȐ=w0mcU`Y?fNDm: M03~&~ۄ~xvAl~ⓡb~őXw~Ne~D~9~0 ~&~u~XJ~$u~x/l(~_ b!~EX~87N~-C~+9~+i/~'&~!H~~~suT~k}%a}ۛ8W}֘2M}ԕC}Ց9s}׎/}׋]&}܈O}ԅK2_vFbl$$eraӌh$WzfjMEmBpB8r-͆u$|xb{D~fu+hk5Xk/`(mMVouLqB:s7цu-Ѕx/$8ze|}&mcso+j+p`rkVtLuAֆwP7x-ӄz$b|Hn}||t%rluYi6Yv{_IZwUS\xK_yAv}z7u{-Ճ|$~ =.{Z"zq{xhM|^3|TJ}Kb}A~,7A~-̃4$WZzR߁3pZgto]džDjTlmJs@ہl7 ,b-w`$iE|yTهp"f:]'r$SJ@k56ق-a$Ӂ0~x{xjoHsdFޛ["rQ܂HÁ ?a^!6΍,-HsAs4jZtia_muXAvO#/wF6y3=zf3燣{+.8|"Ƅ~ڃ\r5]yiqz4`0zW{N|:EƉ|<)}3dž~G+5v~"!%݀vqJh_*W%N5WEg`-d c[seRthJkNA{n8!p0Ns(vk RFy8-|kÝDfjc_hZ.k Rmx A{d?}Oj|lbnaZ,p'QuqI>,sAuf8w60Ey (^oz ׇ[|n~zj raїsY|Pu6Q$voHw@y8bzO0;{({|! ~?i?xaMybXޔz4PzHW{@Y|83}W00~!(~!@^hna~1`j3~XU~PIG@8 :0$( !n!1ZgY_ٔ>Wޒ/O/rG*G?݌"760T(o!{Ȃig#w7_OhWgb6O\iGaq?yI7É0 (?!M*f^ȒVꐨNGƊ?iމ7E/0(\!ȃHf ^GV} 5NF͌4?5[7u/݆(E!ك-l[e~^]בw#V$>NZGF@? /7X$/ˆW(z!ކ}Lb`[@ctS+ f:K9hCmk;nz4(qJ,t%mvy?P|^bnfZehRȞQk"JߛnmUC&ro;lq4tV,v%y{dZ}aŢlVZn/R@oJzqBۗs;&ug4NwP,y?%͋{(=| ~a49rYuMspQqtJvBwu;Gx33z<,{{%}z)~h\`wXxQN8yIzeB@{E;|-3ُ:},Ȍ~&~` _|Xi}P.~Ic~oB~:T3̎g,ԋǀ<&?/$[__$XEPFTI JAғH:ѐPK3J,ߋH&^L T:Ăb^으;WPDnHڔ܆A?:93,vC&t F|iqC^8W3@O喡HAf:.3e5,މ܆7&`H ej؃^+V͘ OHPbA4A:ca3܉x,ىX&憔 }Gł/]Vs1OP`HԐA ^:G]3ulq,Ԉ& C9YfaOQcJflC`Qi<~xk5뛔n/Kq(ݔt"ѐ]wz z*`|X[fQhJSCkC8mRgirvgitFhl?uYnwK q+xc[&|O]`ȥvxc5ifAU]iaQkזYDun?8>q ,\tT !wrD[s^isaytdlug_zvjR xmDy^p7_zs}*{v2}Syo cp-fFqchxFrkkMsmV^suFoQ>vqDx t?7yv*{x<|z̜lRl:mmo?oovpq&j0rDr]st|PuYv&Cvw6xyk*wz2zt{|h it:ku,i|k|tm}Wh@og}[q9~OOs"~eBu~6bv~*lx-z_fphqjnoslf)gXnX[1pLNrNQBFtW6-vW*ox<8 &zϖweg,~iErkYfmhZoz N9qAs5uń*rw `yScHf}hM.qjuel YnvMpAs+5uC*swS yQ:\c ͈eK|gqice2k/YqnM_pWAVrD5tЈ*sv y9lbY.d|fpji$dk\&Ym?M oّ=Ar'(5to*sv xƅaĩ]d{f^ohKd2jXm"3Lor@qː5yt!*svgB xmxZϊnx^<~]yFar)ydez\gYzjM${m@|ep4>}+sq(Z}vA~y9uwcv8e|vh#pwjdxlXynoXLmzLq@{4t4|!v](h}x"~ zrk5sl{ptnoupscvr4WwsKyu?zwu3{1y-(t|Bzj}T|qgprqt zFsu3ntDvUbunwwW?vxKMwy?_yz3zZ{({||}ݏnz|p+{yq{mr|bt(|Vuu}'Jv}?x<~3y~(z~| IimG(nɁwpFlqas&Ut~J3v[>w23ox(zM0{k0mvo*kp`]rBeU-sŅIuP>Pv݄(3Gxab(y΂j{,jӐml)un:jo㌌_q}:TsIMt>vK3!w߅(y`Pz͂iku mzj,o/_pؐ$T,r}.Ht#!=uʊ2wk(xz} iIGkLtplܙink^pOSqDHs=u]2w (xNz\ySyz@xJz΋@|{_z6{-|x[%|}bx wnw8ex|\ySyIzT@Cz팅6{Q-|+%|!}Hwavߝniwhe[wz\%xRyFIy@z<6{'q-{%$|X(#|߄xC[:o@^eÉa\"dRuhH+k">`n!4q+ot,"hFwDփzrw]b3n*ddԇg[E&jQklHQo#>q4̄jt++|v"GyH8{v hlkc̆m#ZozoQqGńNs>/u 4Mw"+y+"΂e{,}4tхokq0bYrYt*P`suGBw!=ڂx4Kz+{y"|فO~gs̓v0jXw=bxv}O46~\FV~=8'40+~#>DPm q+iI܂`WNSvE%Z<04 +#Zq$hS_W"0NLEr<m33ly+~_#o<2pGQg_N~V~M~㊹EY~܉<~A3~+n~#}~τ} ~qo~g8~oW^~UVD~MYM~UE~`zb-{Z|*QԆ|I}]A}98D~1 )3!6LimPagYQ`Ɂ%I7?A@/X9 a0߁i);2{!ցshH`߆m2XP酁H/Av8߂ل80قD) )/" (kf_RP^WOH!n@r58wi0މ))T"!ӆWje []˗_4Uٕrb\MɓtejEƑkh=dk5э~n-ċq&.u x/NV{Fdb%]+ldUHhguMCjEWl=oX5r-ƊWt&Ww\Sya|dh2\Sj^TlLnD_MqbFe?`Eh8ml1JoC*Krr#"uxt{[brL*a=u#w؈zdx|[OgT)j)LlVEΕmn>Γp8r1-Ju@*sw$ y{h}ZmSto[LoqEer>|t7؏Tv\1x(*y$I{Y}k~YTsRtuLuEw> \{7;|1 $}*~$aӅ&/RpX}zR)~Kaq~D|~=t[7e1\1*Y$ÆdbہXQʓKwDU=7i1*ć$߅‚1|˂\}X"bQn6JD=Ȇ7Nᅫ0*ɇ$+SuWӌ0QJzC=jE76@i0Za*͆uN%No c WLPđJ@CFU=L7"0Y*І%Bh>U S]LF_EBb?e8ěi2Ř+j8l2o,̓ar';up!$x8ozv|}'RD_gKiiEql>ynC8Qp2r,ڑuY'+w!֋z!|Cц~5Qˢm=K,nDp>qrc8ct>2v,ߐx'Iz" {5}(QKr_JԞ5sD|ct>Fvc8Kw2y?,z'p|7"B}A\~oQ wmJx9DR#y>)ez#8>{)2|3- }?'~I"~"F-_PŞ[|.Jk|D. }>c}84~O2~- 'Ë,"f…HŁPu4J.D=i,8$i2-/ 'X"ۇ&UK9CpP4%I晖C̖=͔n8 ˄2 b-5]'"΃;iՃOț/I C=7o2k-8.(j#?] |O7IsӌCtc=7a2ى-;-(#1Z4bNVdZf^@haqjecm-h_Uo}kGqn9tHq,]vt y=w^=`acce~f#hp8hkbk"mTmp'Fpar9hs u,/uwD 9xWyZi-]kC:`mI|co7ofq aiJrSl#tFRovd9qx,ty Ww{^Wq&[Ss<^t{xaundv`gwS?jyEmz8p{+s| rv}UkzY{l\{zL_|mc|_fP|Ri}VEXl}8io~+s"~[ vB~1S\%WH$Zy/^eJl#aʂ _1e1R hDk48?oF+r uЀ9QBUFYQx8]ckS`q^d3zQgDk,8n+r!CupP"XT\X[w]\wj_]cS(Q%f~Dfj8n&,q!}u✊N=SJ7W_v[i^ג;]|bPf?D9i!7m,qGY!tڃN RorkCtn6vq*Extzwd'_fSbyhreZwj~hjlj]nm\PupoCYs'rv6utt*.wwPyyv`h.crjdelv;h2niijpo\lrZOoVt=Bqv6Ct\w*vyNy6{r^p$`rcsuf(thnhv[kOwCOmxyB^py5s`z*u{vx}[x^yTazhsdnzg~g.{["i|Nl|Ao},5r}*u?~#w~Y\]*`/rc feZohNk܀An׀5q̀h*tC ww)XɊ.[-~'^ˇra͆edچYgDMkAXn5q.**t*6 JwwVZ8I}:]q:`e2c,YOgM-jDSAmu5upp*;s vUy"Y,N|^\op_ےidc]XfUJLi/@l 5lp&*Ls[ vsTPXT.{[ߚo_ dbfXX{eLi@ld5fo#*\s S v8>SW{ [9oe^Oca֙X-e/Lhh@k5aok*hrˈ v X-mVoZd~qp_^rqaerdYetJh;Luk|@-wtn3yq(-zt|x#)jI_ kb |mdpo4gdpjZXtrqmLt9o?vrL3wt(,ywZ {y@g&gQZi)i{qkko{mmc|noWpqKjrs?Atu3|vw(,xyIz{d]otfpz)hrtncksbmu3Vo7vJqqw>sy=3Kuz(,x{z+}bw[{dx=xgymXiZyakzV"m{;JNpN{>r|3&u }I(8wa}y~`.~0b,we^l`h{`jmU}lIo^>:q3 th(Ovy>^jaxvdAkfЅ `+i]TkIjnr=q.2sǂU(bvFVxL]'́`7ucjeNJ_hpqTskIImЇ=p2s;(tuԃxOt$\/_5u2b+j!d-_giT j`Hm)=o2r (ur7xvB[<(l^btabid/^f+SiÐHlB=wo}2rY+(u"wńP|Z~]^t`i c^2flSliBH[l)`=\o/2r(t wqtVtZ[vfu^ jvav_`w^dSxJh+H+yUkoR=tqWFvlsn;wu0yxw&PzyS|f{ejn:}llorunq}g}p=r\xqtpQsnuFquw^;Zvx0xzB&bz*{{}hu|&jvqZlwfnx[pbyPr'zbEt{8;u| 0w|&yyv}{!~zf|zi;}kpGka}emQ~Zo7~YPXq~Es~:u !0~wb&x.z^eVygɃoZjdl'ZZ>n.Op4E'rB_:tT0mv^&xSioz-#Ed'xfbnhd#k%YmGO_ogDq:ds0^uу&w߃y΂?Sbxemh tcjIY3ltOnDp^:=s$0RuV0&w|y6bwad m9gF$c iXkڐNn"D^ph:rm0Ht4&w+ y>aTyvdlfxbhX|kR#NzmmD3o:rN0@t&v5y zeVyzZoni{/^c{}avY{dN|Xh4C|k|8}n.2~-r $6~uLxw;^KwxaWmxdFbyZg XziMzlC{qoU8_|;r.'} t$`}w~zEWtSevuth+kvzjuawYlW+x~oy4@rF+u"w2mzwoze5m{mgd{j'Z|Fl]Qb|nG}p>N}s4~u_+~w"y| vxllyBncyoZ.zwqP{ sSGz{u=|Kv4|x`+}z"~M{~}jtvrkwbtabx*uYlxvPywFzay={.z34i|{P+||r#}}"~E~stysjuzYav{ Xw{Ox|SFyW|=Wz?}4B{-~+|~#D|Wo}rsQj tp6aukXvzOw|F%xn=yn4!zs+{p#d|\}5qr@i@sB`utoWu:NvEwGg{"ndeꁫgH])1z!cA{h}lO}qd}sE[}tS~uJ~Gw;B=~tx9~y1D~{ )?A|R!}U~kx{wc9|-xZ|yR|zJ}{fA}d|.9y}|1/~#})L~~z!~H jzU~ buz~ZM{H~R{#I|eA|v9I|1}g+)W}ۀu!~A~iyayYz4QzIX{-bAU{#9|11 |)_}H\"},~-i xa+xoY;yHQ+yЈ.I z`oAz8{0|-)b|Ą8"}RxI}ςhhw `wێXxPyHyD@z`8{ 0{>)c|V"0|o}{gvf `/w0Xtw"PxtsHy)@y8z0{M,)e{P"A|}EgW_݌[)W^ObGKhe{?;Yh6чglT.|o&s/EvQIz%g]_=`V[cN؈tfFi>͆l6o.p*r&ÄyuxR{e鈥d<^fV.PiHN.kF1n >e%p6Wr.dun&bwzax|dنpjr]1lUqfnMplEFrV>tG6Av3.Xx#&iz | R}czp\mr/TȃsLLuE;v=vw5y`.Pz'|: 'D}cGv[ƂwT5NxLyDၯz=q_{u5΁%|c.L}R'.~F Z=e+br\|=[!:|S}]L$}D~I=:k~5K4.H5'C$ .܁$a"ZSAKׂDP=  5.C'S vfga&KZ RKx~aD~<~݅f5~.<~=']~ *`~ Y~9Rr~>]K4~&uC~/<~B5m~Ys.6~pS'e~> ~9~Y`2}OY2}R%}J}(C}<}ŋT5]}牿.1~ 'k~+ ~T~u^WW[P47_ HbAGe: Zil2l+3qpQ$M s҆w=z^?]Vda!Od,H7g@ߌj9m 2mQp +<s$zvy {]^dV02fNi5Gk@xan9yp2Ks'+Au$xGXzd}\_iUv3lN]n4G.p+@r)9/t02&v:+CxG$ĄzQ|I~%[|oTЊoqsMՉisFot?pv"8sw2y9+Lz$ꃸ|QȂ}38[u=TEvMewFi$x?~@y8Ѕ\z2|+Z}'%~;/GHBZmczSć{wM|7F|?H6}s8j~1~+gW%175+Y܇/SOoOLEڄ?C8,1T+p8z%L_€Ym&RjLNE>b8xȄR1,+w%bBX)RLۉQEb/>Ƃ8c@1ށk+}%t%ʃ9X?R+K*'E6>8Q1؁+5%'ӄ5VXSOwS[H͖_{B b;efV4ni.uTmb(Gp"$EthRwzU^O a:HidJAg<;&j>4ڎmO.rph(5s"\v͇+y}~|5TcNpfzG撶iAXk:n4p.jFs[(L|v"x%{҄}UTYpi`MkGlm@1o:sq4t.\vB(]Pxo"zK>|~YSnM[pG Drx@t:hu4jpwd.[y(w@z"|mh}i<\StLguFv@s`x:EyE4]Wz.e{(Q}#~6̃SVRy LzF{{ @B={:'|4Rd}m.n~>( #H.1R@Q}LE~F:1@,: 4GR.u!(̄Ł #n^3o1~QFK׃$Eu[?&U9M4;E.z\)(#\`Q;uK߇tEH?E9ԇs40.o(}#f6}Q>K[vE͊?9q?4(]h..f)X#ÁU-ZzMGXG^\=A_;!c5Xf/ٔj=*Zm% -q xuAxP{YL^_F̝aH@(d=:gA5Ij[/m*xIp%@)h:̖k]52n/`p*s%eBvT xۇ{hL}K֛hEk@>XmJ:ow5pq/ԏs*uvB% x z|~KZ$nEo@q:mbsq4u;/Վw *Cx%z |^~1~JsEhotj?Eu:X w,4x/升y*Ћ6{n%|!<~1 _0jJwE=x?ēy:Gz4{/|*O}&~!s^r7J|;E|?}:1~+4~/j+t&:S!gƁfJZD⒰?wu:4㌯/*+S&^n!ӄG@فJD?Q94؋τ0턴+-m&|!4mσTIy.Dx?3W94ϋl0I+:S<&k}"Äu[kP]R `qVBbZYwSeN^9jga]jEeOli0Bol6rp2)uwsnx[vɝYK[b\g^_haub?dheg\gjO kmB-np5q?sV)tTuwhxUQdGXfԁG\RiGt_xkgbm[epNPi;r'AltG5Wpvd)sLxhvzyQltUnYpsso]rf`sZWduMgvxA(kDw5nyW)kr_z=u|"HOusS>v~W?w|r\ZxVe^y&YbyM'fMz@j{~4m|C)sq}u7}̕L}Q}}|Uj~/qYYN~_e]@~Xa<~Le5~@i0~4m')q=thoJvpODC|vSńpyWلKdd[Xn`;LNd?@Oh_-4l~)pB .tgדEHnMz{R[[oV-cZڈW_#Lce@-gd4k<)p+ rtXGb.LmzQ0oU cGY6W^LZKb~@%g4kb)o sԃ:FOKdxzBP7$nTbY#2W`]Kb *@$f}4j*!oa s+ExgJ yOknSbXW)]Kau@#fC5 j*ppt3 ssW'vgvyxߒ`[Tc~j^Yfzra;hnocjbgfmEVi{oJclqq>]ozt2rvK'uhxk&xBzXkԄ[mmy!^omYaq6a~drUgtkIju=n/w2qly#'tzTw|.U4syXu7w\fvZlT_wQ`bxAUf0y0ILiz=m{2kp}{'s|v}ƍR{‚CV|SvZ|ke]}_an}nT|d}Hh~ =il$~V2do~'s(~vuSYPԃn0URuXj\_4`0uScHg=8kUv2^o )( rDv9O!:Sw9u#Wei[On^_vSb|HFf…=j2dnu(0r0u@ME]R/teViiHZD^-^'{S?bHfD=i2ym(Uq̈́zusyL~Q%sUvhYeu]]^BRa_ Geh=ix2m9(uq{u9K~PPsDTBh`Xw]~\R`˒Gd= i 2m+(q9I u iERDjVfv lrZejhm^-^oaSMqUeGsGi1;u]l0w{p^%ys{wFe/ZgF^tiMaw40 t x%vzoy2|9[r{^spaufdxv9[gIwMPTj&xaEPm yt:gp&z/s{&u|x}LqnBsq!7us-wv $@yxlO{z`ditg=kjim`SkoV mq_Kos2Aru7\tdv-vx$Yxzzz|D~b&q2sdrigts_uiu*USlv`K^niwA4px7)sOz -u{H$~x|z'}|_xErbyhey^h;ztTj{Jm6{@o|j7r_}-t}$w^~y?y){^zRiQ4{gl+H|p"D}t6~wyuqZ5ozs&]etP`[uJcQvZfHAwwj >^xm"4yp?+D{Osa"t|vo}ywnzan p(dFdKqfZsi\QtWkGun_=w-p4Xxsw+@z6v"{xx}{vkyhlm{jc]oQlYpnPSr{pGtr=ut4(wv+=y:x"zz~|\|guMhokk5qabwmCrYot0OpuFrv=8txC4vsy+ExR{ "z|o{}t7fvjiQwakxjX[my:O#oz F"quzf-~`DhBW@kNBm>E|o{hf :}i1~nmZ(q txppx(Zgx]^y`UtzcLdzg C{gj1:l|,mW1q}p(}s ~vYyota%frvc]vwfTwi0KxkBynS: zp1G{s(|v?!}x~{kn9r"gelszj<\tllSunlKvpmB{xru9yIt~1&zv){x!F|z~|m onduqFpd[rr S"tsJ~uWtBvvx9x w1yvyz)z{!x|)|Q}\~lmtcolv>[q w_RrxRJsyFAutz?9Ov{=1x|A),z}H!{z~P|Okk{Obm{Zxo|Rq4|Ir}bAttg}9%v ~R0w~)CyR^!z|MqjPjUb#l]YnEQpIJq{A8syj9u;a0v^)Vx`"zde${piiak)BYlm&Q:n8Ip̅A r8tz0vb)hx4V"&yV{Ni gsa j)Yl5Pn Hp@qw8sY0u8)xwɅ"By{Chzg`iXXkpFPmQHo[@qp8sz0u{:)wr"XyZ{ i|S_`W\X[:P!t^GOb?t>fT6Kj.nm&q?uAD(xhG~Z_~]tW`OEcF;g>jjJ6m.np&Zt }wE+zsg{`^|!cV|fSN|hF\}Kk>m}n:6O~,p.W~s&7vry(M{exg(]yiUzXkMzmE{p> |r+6|tT.E}v&~4x~zG}dvm]wogUEx`q+MKy$rEeyt_=zv5{w.?|jyK&}Gz ~|~~?dts\butTvv{ |-}b|qRn[rSsLu#DpvN?=wzg5x.Hy'X{ |H8g}MpapZq~S6rڄKtD9uX2abn튬Z$p|0Rq艎Kxs'D tWQL[gIv_BUb:3f30jW+On$q탸uy{_EYX`]XPք`ILcAȃg:z\ja2m+q$t]0wz^R`HWOc(P3eHhAJk]: n#2ȁp+s$Ӂvkyu[|#]fkVhO~k/H#me@܀o9Ҁq2*t/+Nv$yx{}J]}ql~V}nnN~ pIG~9r@~ls9~u2~wV+6y%%z|+~r\T{xrFUj{sNl|euGK|vb@<}w9j}gx2w}zP+~?{%@~}$~VB[ywTzexMzyF{fz?{{`9E|S|82k|}+}j}%d}~K~ZxL}cTQy}My~]Fz3~?z9'{^r2c|+|B%}Wx}~pZgwSwЂM;xFoy?yʂ9z2_{E+| %|̂m}J~,0Yu߇S}vLJLwlF;x-?xY8y˅2[z;+{%|X})[}݂Yt S.uHLvƋoFwkw?fxG8y62Yz%}+{g%{S|܄>7}UX[%T-Q{XJ[Ce_<؊=c_6-&g,/^!j(*n"Drtv\yWZPՋ]J `C;d+w>yJ>{}Ej @0l[;n6p1ٌ(r-2t(w<$ yt΅{Z}Y`[~E n@`lp;r6Ft]1ފv-J:w(y$O{ }4ك~Dݏ1s@=u;sv6w1≁y:-_ z(| $}q P~Dčx@ ny>;lz[6{T1W|R-r}R)~V$@N )QE'pDb|_@}`;O~96f~14{-)($x/ ÂpV+D?߉V;66T)19l--)H%΂ O|ԂDE?ۄ;"6tv1m-w)aW%5FO!rрehYVM[Q{i^(V5n`Zubc^VjfbJ"if>mFj2Tpn'>tr'wwuTV҅VZLyZ ]m]]a"a``d~UgdgIVgk)=okqnf1o1q'(rtvvwҏOd_RbSx'VdelBZg`U]jXTalHeo]vGbTx<=fy91Wkzt'o{ft*}:Dx[IytN.yicRzI]W~zR\K{tGRa|<e|1ej};'Wo\}s~Bc~GSsL8hQ ]_VRD[G `;e 1rj'n*s^@N}EmrJugO\T QYRF_;dC1ihU'nfvsc>}/C׍r\IgsN`p\SQYF^Ls<c"1h݄'nrςo=1K|BqGg M_\?RΎQX?F]<=c 2hi(.m?ry<*|FA~q}FmfL\RMQWF]1kM(|aRWpW !M\ qC\a9[f /k \&oՄt=9aB1JudG0k_L2aHQ9W=VNRMg[kC^`9se{/j6&o.tgdtN'xeeRRmugVybiZWk^M!mbB@pEf7rj-Aun#xMrzvu_VxvaYl&c]MawfR`VhdLakegAnAj7 qDnW-tDq#w#tyxB[F^ub]aAj`~c`jcPfUf8iKi4lCA)lio6oq,st#vw?-yy~OWwfRt Zihqi]rj_r`lU%cnKg7sf49uj*x,n!z_r|yvy;eVQogYdif][kQ`Q(m^cGogj=qj3tXnL*vq"y9u{zxxwa^mc`cfcYhyfMP@jiFmgk=pn3rq*ut"Bx2wMZzzv]eplS`gbc/iYekOhn*F1kp]ky3FoJ{*r|0"u}Z]x~{rUziuYQz`=\{?W `;{Mc|2Eg=|<j}A3Gn`}*q~|#u<#xAqS(hW_[V^ŀMbtDf)<i—3Qm+q@#Etwq/Rp#vt\Z*wpP׍gT^X~U\^bM2`a=Ddp ;hw3zlt+dpU#t XwWpCOgKSB^tWqU[wM _Dc̋c;g3l +pw#sȄ}w$lrxp,Ohq>R_+rGVUsDZLt{^Cuc:GwZg1yk(jzo* b|zs'~w pkV[g7mtY]n\Tpa`rKqcBsg`9uj0wtna(nyiq {Tu`7}xo%h ]ei`X\kcSmeJohBqk9Asn0vq(qx7t zNww|8zQmdddff[hiRk;kZJmmAoo8r?rG0ptt(sw$w ygyl{r{lakcdmjwg6y k'.zn&c|rWE}|u~yPgYnT][^o`&VHqbNreEth=uk5w\n-yq&qztz|sw}zf3k d ]lf\UnfhMQp0k EArmk=rso5ur@-wt&~yw<{y6}&|ehj\jliTlnALnpDp(q=$rBs5]tmu-vw&xyz{|x}ed:ep\6gr&T;is{LHlFtDynv$r%{-t|'w} fyb~/{kba}Zd}FSFf}Ki<}Ck~)yZr2+;zt$|/wgr}y~|f]rniV"p9kNqmGks/oz@.tqr97vTsp2'wu{+Gyw${-y|{}}\lxo}Uwn qNKorG qhs?s*uw9tv2#vx+cxz4%zF{{}f:}e~[jiuYTlvRMmwKFoxD?qyH8szV2u{x+|w|%8y}4{R~|[[h{Tljo{MwlY| Fqnh|?p}8r}2 t~T+v%dxizˀP|uZgShM jF;m?coZ8q2(s<+v*i%xQzZ|ZgeSgLiɅ_Fk?Kn^8p΄<21s>+u%w7y{͂eZ#dw:SYf]Lh҉~Ek?7m8p" 27rA+u/t%wy>{Y߂P)RT KU6XD[\ =X`6d5/hV(Ձl"*p~t xXV_QYJ]3C`<Md^6&g/fk(րVoi"s%LvgzCW{\P{_I|)bC|e<\}h5}k/B~Fn(~r3"up&=x{VxvbP*xe2IvygBzGjI<{l5{o}/+|r+(}t"~qw[Mz< |UuhOvjjHwClBOx:n;y=p5zDs/%{RuN(|bw#(}my~s{PU}U/sTn6NtEoHuNqBvvs);wt5ixv/,zxB){Pz #d|{}}z~TqEsNr_tH5svAtw=;ivExr5Uwy/3y{);ze|Z#{} }~~. TCo{y'NpyGrzAsz{N;Iu|5Iv|/=x})Zy~#{vU|:%}Sm~YMo<~Gp)Aar'o;3s5Eu/Lw<)zx#z;|wW}[SklMfmGZoqxA>qQ;"rу75Ct#/Zv)xZ$z{} TS1kqM,lG)nz^A"p;rI5Bs/euJ)w愾$5y${dp|͂QɉBPKT`TDX>\8g`2Vd,;*i&SmK τoqy5u y]PV|JZDfy]>7a58d2!h,,NlB&hp !sނwYzP0\aI_Cꁠb=́e7h1l, o^&zr!.uy 9{O,1b.I[dCug=nKj;7~l1o,rn&Nu?!VwSz~D|N}|wgH|j&C|lk=$}Dn7N}p1~;s,~ui&w!z|&ʀ~MzmHcztoBzp<{r71|(tz1|vO,5}jx5&}z!~{M}+M}xrOH xsB{y5u:ÌY,93]D3ag.Ve)xi$rn=r8v*(yI8VCËZ9>b]8a3!eF.N\i)#l$(px tjw~{Ho\CE_p>+b8e3Vi.Ajlf)/o$I6s5vz.gyzɃ%|3G aBJd=gn8]Pj&3%l.,o)3Cr$euقxffmz U};G#afBIi=Pyl8(LnM3 0p.*s)Ju$w {zL|gU~FFkAn7=pL8 r13t$.7v )nx.$ɀz6 [|}LFn~pA~r<~t]7~u2-wh.Cnx)z$|@ }4 \1F}:uA}8w<}Lxf7}}y2}z.R~I{)~}%+~~B ~Tmz5E{zSAJ{{<{|~7|}C2|~.g}1~)}%a}J!~_~KO{Ezh~Azla.e*Ti}&(ml!RqSu xg{k@zS[t;.u79Ew-3x.ay*"{N'|#?~~Fʀ4π>Ղx^;Ay7+{ 3D|.}+~'H#D€̀E8܀e>>|;}7q~3 k/+='v́D# ւ(? ;V7a3 [/+U8' !# 2 ,!#~ ˂mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~D"LkHRSRSTU~V{WyYvZt\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\=9",77RCiMzNMLL}NxOuPrQpSnUlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlWlW8!/:K3QMT`RjSqVsKOXdmrȩpΟoӕn׎pٌwڌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}ٌ}>K2PMQ\PdPgFxJOZemlǟk̗kАkӊnՈsֈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈyՈy?J2OLNVLYFbD|JQ\ggfÕfȏfˉg΅jЃoЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃsЃs@J1MIJLFJ?hELT_`aaaÇbƂcf~j}n}n}n}n}n}n}n}n}n}n}n}n}n}n}nBH0I?C;8P@kHPXXYZ[\]{_yawewhwhwhwhwhwhwhwhwhwhwhwhwhwhwhCG.A/189UCmLTRQST~UzVwXtZr\q_pbpbpbpbpbpbpbpbpbpbpbpbpbpbpbAA$+ 2=SEkL~SWVWXZ|[x^uasesjsqssssssssssssssssssssssssss9I(F.=%7>>XGmO~SQPRSyUuWrYo\n_mdlilklklklklklklklklklklklklk;F#<-(8CAZJmN{LLL|MvOqQnRkUiWhZg^fbfcfcfcfcfcfcfcfcfcfcfcfcfc>< 1.:EEYIjGwGG{HsHmJiLfNePcRbUaX`[`]`]`]`]`]`]`]`]`]`]`]`]`]= '40>DBVAeAqAzyBqCjEfFbH`J^L]N\P[RZUZVZVZVZVZVZVZVZVZVZVZVZVZV! ,70;A:P:^;hxOUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWf^tcimqv|あzwwwxz|Ӏσσσσσσσσσσσσ*8&D>OUWe^sdimpu{ㅁ}yxxz{σ˅˅˅˅˅˅˅˅˅˅˅˅*9&D=OUWd^qd~impsz㋀|yz{τȇÇÇÇÇÇÇÇÇÇÇÇÇ*9&D=OUWc^pe}hlqsx~ހ{{}ЃȈ˽˽˽˽˽˽˽˽˽˽˽˽*9&D=OUWb_oc{fjosv}Ꮓޅ}}ҁȆͺͷͷͷͷͷͷͷͷͷͷͷͷ+9&D=OTWa_mbyeimquz◂ٍЃˁɃкϴбббббббббббб+9&D=OSX`^l`xcgkosyݠєNJҾҸҳҮҬҬҬҬҬҬҬҬҬҬҬҬ+9&E=OSX_]k_vbeinsy֥~˛ͷӳ԰Ԭԩԧӧӧӧӧӧӧӧӧӧӧӧ+:%E=ORX^\j^u`dinsݳvѪ{šù̯ө֧֤֢աաաաաաաաաաաա+:%E=OQX][h]s`}dhnpظr̯x~ǫ́ԟ؜؛؛כ֛֛֛֛֛֛֛֛֛֛֛+:%E=OQX\Zg\q_zcholҽpƵv{­ˡӕِڑڒٔؔؔؔؔؔؔؔؔؔؔؔ+:%E=OPX[Ye[o^wb~hkhmsx}ʚӌن܆ۊڌٌٌٌٌٌٌٌٌٌٌٌ+:%E=OOWYXcZl]sbxi{eejptyɒ}҅ڀن؇؇؇؇؇؇؇؇؇؇؇؇+:%E=OMUWW`Yh\nbqex^bglptȊx~{zՃԃՃՃՃՃՃՃՃՃՃՃՃ,;%E"L2J3E.=;DSIhOzUVTVW{Yu\q`oenknso|oӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂoӂ/?"I)C%3'yf@}aB]DZFYHWJVLVNUQTTTVTVTVTVTVTVTVTVTVTVTVTV*2!121@3M}4Xt6ak8hd:n^tW@vUBwTDxSFyRHzQIzPLzPN{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{OP{"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmuz|sommnopqtwzzzzzzzzzzz"1 >7IMQ\Xi^vchmt{{tonnnopqux{{{{{{{{{{{"1 >6ILQZWg]tchlryyspopqruy}~~~~~~~~~~~"1 >6ILQYWf]rb~glpw~wrpqruy}ŀŀŀŀŀŀŀŀŀŀŀ# 2 >6IKPWWd]pb|gkou||tqrsx}ʀÁ# 2 >6IJPVWb]nbzgkns{炃ytuw{Â# 2 >6IJPUWa^lcxgknrzኁـyxz}¼¶²òòòòòòòòòò# 2>6IIPTW_^kbufjosyے҇|}źĵİŭŭŭŭŭŭŭŭŭŭŭ# 2>6IHPSX^^iase}inrߣy՘~ˎ»ǸǷDzǮǪǨǨǨǨǨǨǨǨǨǨǨ# 2>6IGPRX\]g`qdzhmrڨvО|ŕ²Ȯʬʪʧɤɢɢɢɢɢɢɢɢɢɢɢ# 2>6IFPPY[\e_ncwgloլsʤyɥ̢̡̟̝˜˜˜˜˜˜˜˜˜˜˜# 3>5HEQOYY\c_kbsgzl۹kбqũw|ɛΘϖϖΖ͖̖̖̖̖̖̖̖̖̖̖# 3>5HDQNXW[`^hbogth־h˶ntz~ɒύыьэώΎΎΎΎΎΎΎΎΎΎ# 3>5HCRLXUZ]]daigmbfŻlqv{ȉςӀ҂҅Їχχχχχχχχχχ# 3?5HBSJWRYY\_`bck]~cinsw{ǂ{y{πππππππππππ# 3?5I@THUOWTZXaX[jZ}afkosv{|utt{|||||||||||$ 3?5J>SETJUNYN]QWhY{]bgjm~qtxppovxxxxxxxxxxx$ 4?5K9)B@HUMgRvPPP{QsSlWg[ebdidpeyeۃfیfیfیfیfیfیfیfیfیfیfی& 8F;-:0BEHXMiKwKK|LsMlPgSdWb]abahaoaxaaaaaaaaaaa':;  1;5CHHZFiFuF|GsHkJeLbO_S^W]\\a\f\m\t\t\t\t\t\t\t\t\t\t\t(:$4#>8AI@Y@fAq|BzsCkDeF`I]L[OYSXVXZW^WdWiWiWiWiWiWiWiWiWiWiWi'+7&;89G9U;a{JGQQX\^fcpgzkpޖxՋ~́zxyz| +8/B=JFROYY_cdlhvlp؛vϒ|ň||~ +8/BVDXJZP^S_^]qʻdjpuy~}{}ǀƂłłłłłłłłł +8.C5N -% 6@3FEGVEeEqF{wGmIeK_O\TZZYaXhXpXxY悖Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕Y犕./+9$A7BG@W@dAoxBxnCfE`H[LYPWUVZU`UfTlTuT|T|T|T|T|T|T|T|T|T|!0<';89G9U;`wqf@x_B|ZEWHULSPRTQYQ]PbPiOoOoOoOoOoOoOoOoOoOo  & 13(272D4Pv6Zm8ce:i^\F@]EC^DF^CH^BK^AN^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^AQ^ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #}2*x@>~GIMUTbzZmsbxmket`~\ZZZ[[\]Õ`ǔcɔf˓iΓkГkГkГkГkГkГkГkГkГ #~2*z?=FHMTS`~Ylw`wpjisb|][Z[[\]^Ėbǖeɖh̕kϔlѕlѕlѕlѕlѕlѕlѕlѕlѕ #2*~>;EEKPQ\Wh]s{d~smkwc_]]^_`œeśițl̚oϚpΛq͜q͜q͜q͜q͜q͜q͜q͜q͜ #2*=9DCKNQZWe]qb|ykptg~a__`bdhƝlʝo͜q̝r̞s˟s˟s˟s˟s˟s˟s˟s˟s˟ #2*<8CBKLQWWc]nbyiwrn{fccefhkȟo˟r˟sʠuʡuɢuɢuɢuɢuɢuɢuɢuɢuɢ #2)<7D@LJRUX`]kbvg~puymhhijkmɢrɢuɢvȣwǤwǤwǤwǤwǤwǤwǤwǤwǤwǤ$2);5D>LHRRX]]hbrg}o~wunllnopĦtƦwƦxƦyŧyŧyŧyŧyŧyŧyŧyŧyŧyŧ$2);4E=LFSOXY]dbngyn݇w}}uqpqstvĩyĩzĩ{ê{ê{ê{ê{ê{ê{ê{ê{ê{ê$2);3E;MCSLYV^`bjgtߘo~֎u΅{|vtuvwy¬{¬|¬}}¬}¬}¬}¬}¬}¬}¬}¬}¬$2)<1E9MATIZR_[cegnڝl|єsȌy~|yyz{|~~$2)<0F7N?TGZN`Wd_ުfjբjz̚qÒw|~}}~$1(&H)Q,Q,S+K8OMW`]qchlptvymkjjmoppppppppp%2 >#I%N%N$O D6MKT^Zo`~dhlzoouhgffgklllllllll%3>J JH@D4KHQ\Wm\|`c}fqjhqc}bbaa«f¬ggggggggg%3?ID? DJ1MEOYSjWyZ]t`idam_{^Nj]ɜ]ʬ\¤`ǤbƦbƦbƦbƦbƦbƦbƦbƦbƦ%3?B8 7C!L3QETVRgSvUvWjY`_\jZyZوYڙYܩYݽ[͜\̝\̝\̝\̝\̝\̝\̝\̝\̝&3? 5&8C(J:NKN[MjMwxNlOaRZYWdVrV倘W掖W睕W笔WX˓X˓X˓X˓X˓X˓X˓X˓X˓% 1 6+ :C.I?HPH_Gk{HvoHdJ]OXUU^ThTtTTꋐT똏T릍T챍T챍T챍T챍T챍T챍T챍T챍T챍#* 0mUAqQEtOIuMNvLSwKXwJ]wIcvIjvHruGxuGxuGxuGxuGxuGxuGxuGxuGxuֱ# )+',4|-?q/Jh1R_4YY7_T:cP=fMAhKEjJIjHMkGQkFUkEZkD_kCejCjjCjjCjjCjjCjjCjjCjjCjjCjj̼ ##{$/o&9f)B^,IW/OR2SM5WK9YH<[G?\EC]DF^BJ^AM^@Q^?U^>Z^>]^>]^>]^>]^>]^>]^>]^>]^>]^ yn'd0["8U&>O)CK,FG0IE3KC6LA9M??O=BO{GIyNUuUam]lfgv^q~W{TRRRRSSŇẆ[φ^҆bՅdمf܆f܆f܆f܆f܆f܆f܆f܆f܆x tq-%u83|?=FG~MSzT^s[jkdtcn}[yVSSTUVWÊZ͉^Љbӈe׈gڈhۉhۊhۊhۊhۊhۊhۊhۊhۊy ur-%y71>;FEMPS\yZgqbril|`vZWWWYZ[]͋aыeՊhيiڋjٌk؍k؍k؍k؍k؍k؍k؍k؍y vs-%|60>9FCMNSYYex`ppizgs`}\[\]^`aˍeӍh׌j؎k֏m֐mՐmՐmՐmՐmՐmՐmՐmՐz xu-%5.?7FAMKSVYa_lwgwnpfza_`acdeɐgԐk֐mՑnԓoӔpӔpӔpӔpӔpӔpӔpӔpӔ{ yv-$5-?5G>MHSRY]^i~etwn~nwhddefghĕjҔnҔpҕqіrїrїrїrїrїrїrїrїrї| zx,#5+?3G;NESNYY^ddomzxuo}jhijklmϙpЙrϙsϚtΚuΚuΚuΚuΚuΚuΚuΚuΚ} {{+"5)?1G9NATJYT^_cj݉luրswzpmmnopqȜs͜u͝v̝w̝w̝w̝w̝w̝w̝w̝w̝w̝} {}*!6(?/G6N>TFYO^YddؐkrЇqxw~sqrstuvʠxʠxʠyʠyʠyʠyʠyʠyʠyʠyʠyʠ~ |* 6&@-G3N;TBYJ^Sܞc`Ӗipʎo~†u{yvvvwxyȣzȣ{ȣ{ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ|ȣ }*6%@+H1N7T>YE^Lآ`^Λhnœn}sy{yz{{|Ƨ}Ƨ}Ʀ}Ʀ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ}ǥ ~*6#@(H.O4U9Z?ݭZIӧ^\ʠfml{rw|}}~~ªĪĩŨŨŨŨŨŨŨŨŨ~*6!@&H+O0U4Y8ٱUHϪ\[Ťdkjypuy¬êêêêêêêêê*6 @$H(O+U.V2մRFˮ[Ybihxnsw|~¬¬¬¬¬¬¬¬*6@!H$P&R(ܼO1ѸQDdzYW`hfvlquy~zwvttvyzzzzzzzz*6@H O O F/ͽOC·WU^fduinrv{zrnmllnqrrrrrrrr*6@HKID-MAUS[dasfkostwkhggfi¬k¬k¬k¬k¬k¬k¬k¬k¬k¬*6?HE9B*K>RQYb^pc}gjxnmsf}ccbbeƦfŨgŨgŨgŨgŨgŨgŨgŨgŨ*5?B ;3?(H;ONU_Zn^{b{fpifpa{__^^`ˠbɢbɢbɢbɢbɢbɢbɢbɢbɢ*4 = 7!4>$E8LKR\VkZx~]r`gd_l\x[[ZYºZИ]Ϛ]Λ]Λ]Λ]Λ]Λ]Λ]Λ]Λ ) 26);E!I5JGNXQgTttViY__ZhXvWυVЕVҦUӸUҏWՐXՑXՑXՑXՑXՑXՑXՑXՑ&*.=F&J8JHKWLevNqkP|`SYZVeUsTT⑈T㠇S䰆SŅS؅SچSچSچSچSچSچSچSچ3 ?C-D=EKEYxFelGpaIxYMSTP^NiMwLLKKJ}K}K}K}K}K}K}K}K}ٸ'5;!=1>@?Mz@Yn@dcBlZDsSHxOO{LW|K`|Ik|Hv{HzGyGxFwFwFwFwFwFwFwFwFw ٮξ( 15%738@z9Lo:Vd;_[n2Hd3Q[5XT9^Of=f=f=f=f=f=f=f=fѱ #&$x)/m*:c,BZ-IT1ON4TJ8WG=YEA[CE\AJ]?O]>T]=Z]<`\:g\9o[9s[9s[9s[9s[9s[9s[9s[9s[ǻ  wl )b#2X$:R(?L+DH/HE3JB7L@;M>?N,<<0>:4?87@7;@5>A3BA2FA1JA0NA.SA.UA.UA.UA.UA.UA.UA.UA.UAib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[nib[+"\7/c?:dFDaOP\XZUbdOlkJwpGrFsEsEsEsErFrFrGqKqOpSpUpXo[n[n[n[n[n[n[n[njb\+"_6.f>9gECdMO_VZX`dQjkLupHsFtEtEtFtFtGsHsIsMrQrTqWqZp\p\p\p\p\p\p\p\pkd]+"c5-j<7lDBiKMdTX]^cUhkOrqJ~uHvGwGwHvIvKvLuMuPtTtWsZs]r^t^t^t^t^t^t^t^tl e^+!g3,n;6qC@oKKiRVc[a[ekSprN{vKxJyKyLyMxNxOwQwSvWvZu]u_u`w`w`w`w`w`w`w`wl f`*!k2*s:4vC>uJIpQTiY_aciYmrSxwOzN{O{P{QzRzSyUyVxZx^w`waybzbzbzbzbzbzbzbzm gb*!o1)x:2{B;{IFwPQpW\hag`jqXuxT|S}S~T}U}V|X|Y{Zz^zazb{d}e~e~e~e~e~e~e~e~n hf)t0'|:/B9IC}PNwVYo^dgho_rwZ|}WWXZ[\~^}_}a|d~efhhhhhhhho ij'x0%:-B6I?OJUUw\`oelgou`x}]\]^_`aÁaԁdgh߄iޅjޅjޅjޅjޅjޅjޅjޅjޅp km&|0#9*B3IDߵIԵE'ʱN:WK^[djiwnrv{xusrpqƦtǤvɢvɢvɢvɢvɢvɢvɢvɢx v#-6=Bۺ@йC%ƵM8UI\YbhgulptyxpkjihiǥkǤnȣnȣnȣnȣnȣnȣnȣnȣx y " -5; > 5˾A"K5SGYW_fdsim}qrui|eddcdʡeɡgɡgɡgɡgɡgɡgɡgɡgɡz } " + 3 742? H3PDWT\cape|ivmkrdza``__͛a͜c̝c̝c̝c̝c̝c̝c̝c̝{ !)/./ <F0MATQY`]nayydnhen_x]\\[[˔\ҕ^ї^ї^ї^ї^ї^ї^ї^ї} %%+ 9B,J>PNU]Yj|\vq_fc^jZvYXXWWʌWٌY֏Y֏Y֏Y֏Y֏Y֏Y֏Y֏ )6?(F:LJPY}SfsVrhY|^^XgVsUƁTȑTɡSʲRȃSTޅTޅTޅTޅTޅTޅTޅTޅٴ2=C%F5HEKTtMbiPm_SvWZ|Sd~Rq~Q}Pَ|PڞzPۯyOxNwOzOzOzOzOzOzOzOzڬк#3 :?*A9CGvDTjF__IiVMpQTtN^uMjuLwtLsKrKqKpJoKnKnKnKnKnKnKnKn ѳ&06 :.<\LCaHIcDPeBWe@`e>kdVCCX@IZ=OZ;VZ:^Z8hY6rY4|X3W1W1W1W1W1W1W1W1W˰ ~u# j&*`(3X+:P-@J0EE4HA8K>=L-<;1>96?7:@4?A2DA1IA/OA.UA,[A+b@)k@)k@)k@)k@)k@)k@)k@)k@yo e [ SK E%?):!,7%.4)02-1112/52-93+>3)C3(H3&M3%R3#Y3#Y3#Y3#Y3#Y3#Y3#Y3#Y3[S H+ M3(T;2TD=RMGMWQGbXBm]?y`=aa?`?`@`A_C_G^K^M]P]Q\Q\Q\Q\Q\Q\Q\\SI+ P2(V;2VCb=b=b>b?b@b@aAaBaC`E`I_L_O^Q^S^S^S^S^S^S^S^]UJ+ T1'Z91[B;YKETTOM^XGi_CubAd@e@eAdBdCdDcDcEcFbHbLaOaR`T`UaUaUaUaUaUaUa^UL*W/%_8/aA9^IDYSNS\XLg_GsdE~fDgCgDfEfFfGeHeIeJdKcOcRbUbVcWdWdWdWdWdWdWd_VP(\.$d7-f@7dHB_QLX[WQd_KoeH{hGiGiHiIhJhJhKgMgNfOeReUdWeYgZgZgZgZgZgZgZg`XT&a,"i6+l?5kG?eOJ_XUXb^QlfMwjKkKkLkMkNjOjPiQiRhShVgXgZi\j]k]k]k]k]k]k]kaYX%f, o5)s>2rFWI{`Ushbkpoexwc{b|c}c}d}e}e}f}g}i~j~kkkkkkkkg `o})2; B'I/O8ߊVB؃_P{f`smmmtwh|}ggghiijɁk݂lmnnnnnnnnh ar(2:B#H*N2ۑV<ӊ]M˂d]{kktqvox~lkkllmnÆnֆo݆p݆q݆q݆q݆q݆q݆q݆q݆q݆i du(1:AG$ߚM+זT:Ώ\KƈcZih{otuu~q|ooppqqrъrڊsڊsۊsۉsۉsۉsۉsۉsۉsۉi gx'19@FܟJ%ӚR8ʔZHaXgfms|r}wytsssttuˎu؎u؎u؍uٌuٌuٌuٌuٌuٌuٌj iz '08>D٣G#ϞQ6ƙYF`Vfdkqp|}vy|wvvwwwƒwԒwՑw֐w֏w֏w֏w֏w֏w֏w֏k l} & /6<ߨAէE"ˢO4XD_Tebjoozs~yzyyyzzzҖzӔzӓyԒyԒyԒyԒyԒyԒyԒk n % . 5 : ۬<ѪD ǦN2VB]Rc`hmmxqv|}}|{}y}x}v~ϙx}Зy|Җz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕz|ҕl q  % , 2 6 ذ5ͮBêL/T@[Pb^gkkvos}xvsqonm̛nϙqИrїrїrїrїrїrїrїm t $*.ް/Ӵ3 ɲ@J-R>YM_\eiitmqwun|iggfeȚfϙhИjИjИjИjИjИjИjИn x "'(ڶ"ϸ1 Ķ>H+P;WK]Ybfgrk}{opsgycaa``ǖ`іbіcіcіcіcіcіcіcіo |!Իɽ.<F(N9THZV_dco~gztkjpbx_^]]\Ɛ\֐^Ց^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓ^Ԓq ׸+9C%K5QEWS[``lwcwmgcm]v[ZYYXĉX܈YۊZڋZڋZڋZڋZڋZڋZڋr ְϼ&5?!H2NASOW]y[io^sec|]iXsWVVUT€TUVVVVVVVw ٪е 0;D.J=NK{RXqVdfYn]^vWe{Tp|S~|R{RyQxPwPvPwQyQyQyQyQyQyQy  ۢѯȻ- 8?)E8|IFrLSgP_^ShVYoRbrPnrO{qNЊpNњoMҫmLӾlLkKlLnLnLnLnLnLnLnөɵ"0 8=(~@6sCChFN^IYVNaQUeN^gLjgLwfKdKcKbJ`J_H_FaFaFaFaFaFaFa֢˰#-4~8+t;7i=B_?LVBTOHZKN^HW_Fa_El_Dz^C\B[BZBYAX@W@W@W@W@W@W@Wۛͫø! )}.t2+i56_7?W:GO=MJBQFHTBOV@WV>aV=lU;yT9S9R8Q8Q7P7P7P7P7P7P7PЦŴ |#r(h+)_.2V19O4?I8DE=HABJ=HK:NL8VL6_K4iK3uJ1I/H/H.G.G.G.G.G.G.Gǯ y of]#$U'+N*1H.6B2:>6<;;>8@?5E@2L@0S@.[@-d?+n?)x>'>&=&=&=&=&=&=&=vm cZRL"E"'@&+;*.7.0421272/<3,A3*G4(M3&U3$\3"d2 m2t2t2t2t2t2t2t2tja XP HB<7!3 "0#$-'$++%)0%&4%#9&!?&E&K&Q%X%^%^%^%^%^%^%^%MD"<- A0"F8*GB5EL>AVE=aK:nN8zP7P7P7P8P9P9O:O;OM?LBLDKGKGKGKGKGKGKGKNE"?+E."I6*K@4JK=EUFA_L=kP;xQ:R:R:R;RP?P?P@OAOBNEMGMINININININININOF!B)H-!N5)P?3NI=ISEE]LAiQ>uS=T=T=T>T?S?S@SARBRBQCQDPEPHOJOKQLQLQLQLQLQLQQG!E(L+S4'U>1SG;OREI[MEfRBrUA~V@V@VAVBUCUCUDTETFSGSHRHQKQLRNTOTOTOTOTOTOTRH I&Q)Y3%[=/YF9UOCOYLIcSFoWDzXDYDYEXFXGWGWHVIVJUKULTMTNUPVRXRXRXRXRXRXRXSJ N$W(`2#c;-aD7\MAVWKP`SKkXIw[H\H[I[J[KZLZMYNXOXOWPWQWRYT[U\V\V\V\V\V\V\UKS!]'f1 j:)iC3dK=^THW]RQhYNr]M}^M^N^O]P]Q\R\R[SZTZUYT\V^X_YaZaZaZaZaZaZaVMXd&m0q9&pA/mI9fQD_[OXdXSo^RyaRaRaS`T`U_V_V_W_W_Y_XaZc[d]e]e]e]e]e]e]eWO]i%r/w8"x@*uG4oO?gXJaaU[k^WucVdWeWeXeXeYeZeZe[e\e\f^h_i`jajajajajajajXSbo$x.}7~>%|F/xM9rVDk_Pdh[^qd[zh[j[j\j\j]j^j^j_j`j`kbmcmdndndndndndndnZWgs#}-5=!D)L3{U=u]JleYfmdauk`~n`o`o`oaobobocpcpdpeqfrgrgrgrgrgrgrgr[[kw#+4<C#J,ڄT7|[GucVnjchqlezqdsdtdtetetftftguhuiuivjvjvjvjvjvjvjv\^o{" *3:AݎI$ԉR4̃ZD|aSug`onkkuri}vhxhyiyiyjyjykykylzlzmymymymymymymy\br ~" ) 18?ٔG ЎP1ljXA_P|f^vljqrsnyyl{l}l}m}m}m}n}n~n~o}o}o}o}o}o}o}o}]eu ! ( / 6ޚ=՘E̓O/ÎW?^Nd\}jhworsvyq}~poppppÂq؂q၌q။qဋq​q​q​q​q​q^g x &- 3 ۞8 ћDȗN-V=\KbYhf}mpysyuysrrssss҆sޅs߄s߃ssssss_j {%+/آ5 ͟BěL+U;[IaWfdko~pxzuw}uuvv~v}v͊|vۉ}v܇}u݆~u݆~u݆~u݆~u݆~u݆~u݆`m }"'ޣ*ԥ3 ɣ@K(S8ZG`Ueajmnws{y}yzyxyvyuyszȍszٌtyڊvxۉvx܈vx܈vx܈vx܈vx܈vx܈a p "ۧ!Ш1 Ŧ?I&R6YE_Rd_hklup{ut~}p}n}m~k~j~ďi׎l}ٍn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋn|ڋb s֫ˬ/=G$P4WB]Pb]fijs}n}trlygedcba؎c؍eٌfٌfٌfٌfٌfٌfٌc wި Ѯư,;E!N1U@[M`Zdfhqxl{npeva_^^]\֊]ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊ_ڊg { ԫ˲)8CK.R=XJ]Wac{enrjxhn`u\[[ZZYՃYބZޅZކZކZކZކZކZކl  զͯķ &5 @H+O9UGYT}^`tbjkftbk|[sY~XWW~V}U|U}VWWWWWWq   ؠϫƴ!1 <E'K6QCUPvY\m]fcbo\hvWqyU}zTyTwSvRuRsQtRvRwRwRwRwRwRwxܙѥȰ+8A"G1L?xQKnTWeXa\]iVdoRnpQzpPoPnOlNkNjMjMmMmMmMmMmMmMm՟˫%2;B,yG:oKFeOQ]SZUXaQ`eNkfMxeLȆdLȕcKɥaKʷ`J_J^GaHbHbHbHbHbHb٘ͦñ !. 7z=&pB3fE?]IJUMROTWL]YJhZIuYIكWIڒVHۢUGܳTGRFQDTCUCUCUCUCUCUߑѡƭ",z2p7'f:2\=HACDGFAOG>WH=aG;lG:yF9E8C8B7B7A7@7@7@7@7@7@˥~v m d%\*#T.*M21G66B;9>A<;G=8N>6V>4_=3j=1w22D20K3.R3,[2*e2(p1&|0%0#/#/#/#/#/#/#/zqh_ WOHB=!8%"4)#1.$.3%,8&)>&'E&%L&#T&!]%f%o$z$}#}#}#}#}#}#{oe\T LE > 840,)"''$+!05;BIQX`cccccc@7%5,9/ ;5$=@+;K49V:6b=5o?3{@3@3@3@4@5@5?6?6?7>7>8>9=:<:<;;<;<<<<<<<<<<<3#A>+?I4<>==>===????????????B9$;(@*C2"E=+DH4@R;=]@;jB9vD9D8D9D:C:C;C;B@?@@?@?@?@@BABABABABABAC:#?%D(H1!J;)IF3FP;B[A?gD=sF<~FE?E?D@DACACBBCBDADACBDDFEFEFEFEFEFED;#C#I'O/Q9'OD1LN:GXACcFAoH@zI@IAHBHBHCGDGDFEFFEGEGDHCHEGGHHJIJIJIJIJIJIE>!G!Q%V.Y8%WA.SK8NUAI_GFkJEvLELEKFKGJHJHIIIJHKHLGLFLGLJKKMMNNNNNNNNNNNNGCMW$]-a6!_?+[H5UR>P\GLfLJrNJ}OJNKNLMMMMLNKOKPJPJQJQLPOPQRRSSSSSSSSSSSSHGS^#e+h4h=&dF0^O:WXDRbLOmPOxRORPQQPQPQPRPRPSPSPTQURTTUVVWWXWXWXWXWXWXJKYd"k*o2p;!mC*gL5aV@[_JViQTtTT~VTVTVUVUVVVVVWWWWXWYXXZY[Z\[\[\[\[\[\[\KP_j!q(v1w9uA$pI/kT:d]E^eQZoXXx[X\X\Y\Y\Z\Z][][]\]]]]_]`^a_a_a_a_a_a_aMUdo w' |/~7}?yH'uR3mZBfbOajY^s^]|a]b]b]b^b^b_b_b`c`c`daebececececececeNYh t {& , 5=ۂG |P0uX?n`MhgXdo`bweafagagbgbgchchchdhdieifififififififiO\l x $* 2 ߊ:ևD΂N,|VN9.8E06L04U02^01j//w..--,-+,++*+*+*+*+*+*vme ^ VOH!B&<* 8/"55$2;%/A%-H%+Q%)Z%(e$&q#$~#""!!!!!!!!!!!!!!wkbZS LE>94 0%-*+/(4%:"A IR\fq|wk`WOH A :5 0,(&#" '+17?GP X aiiiiii3*)-*0-04 1?$0K(0W,/c/.o0-{1,1-1-1.1.0/0/00/1/1/2.2.3-4,4,4,3-3.3.3.3.3.4*(0(3+43 5=$4I)3U.2a11m20y3/3030212222231314040505/6.7.7-6.6060606060605,'3&7(:1;<$9G)8R/6^35j44v5353544545463637372829191:0;0;0:193939393939360$8#<%@.A9#@D*=O0;[49g68s78~7878796:6:6;5;5<4<4=3>3>2?2>4=5=7=7=7=7=7=785!= C$G-H6!FA)CL0@W6>c9=o:=z:=:=9>9?8?8@8@7A7B6B5C5D4C6B8B:A;B;B;B;B;B;9:BJ#O+P4N>&KI/GS6D^;Bj=Av=B=BI>J=J=KL@KBKDLELELELELELE<COY _(`0_9\B'VL2QV:Ma@LlCLwCMBMBMBNBNBNBOBOCOCPCQCPFPHPIQJQJQJQJQJQJ=HV`f&h.h6e?"_I,ZT7U]?RhEQrGQ{HQHQHRIRISISISITITIUJULTMTNUOVOVOVOVOVO?N\ f l% o+p3n<jG%dQ0^Z=YcFVlLUvNU~NVOVOVOWOWOWOXOXPYPYQYSYSZTZTZTZTZTZTCRa k r# v) w1v9sEmO,gW:a_F\hNZpRZyTZTZUZU[U[U[U\U\V\V]W]X]X^Y^Y^Y^Y^Y^YGV f pw!{'}- }7zCuM)oU7i]DcdN`lU_tX^|Z^Z^Z_Z_[_[`[`[`\a\a]a]a]a]a]a]a]a]JZ jt{$*ك4 πA{K&uS4pZAkaMfhUdp[cx^b_b_c`c`c`c`cacadadadadadadadadadaM^ mw އ%ԇ2ʅ?I#|Q1vX>q_JmeTil\gs`f{cfdfdfefefefeffffffgegegegegegegeP b pzڋЋ0Ɖ>H P.|W]IaTe_|}jhuyopowvvkvxiuygvyevydvxcvxbvwdvueutftsftsftsftsfts_q~݈Ԑ͖Ě&5 AI"Q/V;[G`Rd\whfolog}svc{{y`{z_{z^|y]|x\}w[}v\{u^yu^yt^yt^yt^yt^ytbuًГȚ "2>GO,U8ZD^OzbYrfcijlapt\ywZxYwYvXtWsVrVsXsXsXsXsXsXsgy߅ԏ˗Þ/;EL)R5XA|\Ku`Vld`dii\ooXxrVrVqUpUnTmSlRmSnSnSnSnSnSnl}ډϓƜ+8 BI%O1~U=wYHn^Rfb[^gdXniUxkSkSjRhRgQeQdOfOgOhOhOhOhOhrԎʘ&4 >F!L-xQ9pUChZM`^VYd]TlbQvcPbOaO_N^N\M[L]J_K_K_K_K_K_yۇϔŞ /:AyH(qL4hQ>`UGYZOS`UOiXMtYLXLVKUKSJRJQIRFTFUFUFUFUFUԎɚ(4 y<qB#iG.`L8YPARVGN]LKfNIqNH~LHKGJGHFGFFEFCIBJBJBJBJBJۇ͕¡ ~x,p5h<`A'XF1RK8LQ>HYAFbBEnADz@Dʈ?Cʘ>B˨=>=>=>=>=Ґƞzrn#g- _5X:Q?(JE.FL3CT5B^5Ai4@v3?܄2?ܓ0>ݣ/>޵.=-<,:/9090909090ɚ{qkd]& U,N1G6"B='>D*;L,:U,9_,8k+7x*6)6(5&4%4%3$3$3$3$3$3$|qhb[TM$F)@/;5 8;"5B#3J#1S#0]"/h"-v!, +*)))))))~rg^X QJ D>!8&4+11.7+=)E'N%W$c"p ~sg\TMG@ :50- *%&*#0 6=FOZfr~      tg\RJC<6 1 , ($!"'-4 < EOXblooooo&!!)%)',%3&>&K%W%d!%p"${"$"%"%"&"&!&!'!(!( ) )*++++** * * * * '!#'(&*)+1+<*I!)U!)a#)n$(y$($($)$)#*#*#+"+","-!-!. / //. .!-"-"-"-"-"( '%,#.&1/1:0F"/R#.^%-k&-v&,&-&.&.%/%/%0$0$1#1#2#3"3!4!3!2#2%2&2&2&2&2&)+!1 4#8-886C"4O%3['3g(2r)2})2(3(3(4'4'5&5&6%7%7%8$8#9#8%7'7)7*7*7*7*7**/6@";K&9W*8c+8n,8y,8+9+9*:*:););(<(<'='>&>&>'=*=,<.^.=j/=u/>~.>.?-@,@,A+A+B*B*C)D)D*C-B0B1A3A4A4A4A4A4/;CLQ&Q/O8JC$GN+DY0Ce2Cp2Cz1D1E0E/F.F/F/F/G/G/G/I0H3G5G7F8F9F9F9F9F94@KUY%Z-X5S? NI)KU0I`4Hk5Iv5I5I5J5J5J5K6K6K6L6L6M7M9L;LK>K>K>K>9ER \ a# b*a2];XG#TQ-P[5Nf9Np;Ny;NQ@PBPBPCPCPCPCPC>J X bg! j' i/f8cD]N)XW5T`GN)T5Y@]J|bTxyf]rvlelssjhr{mfrndrncrnarm`rm_rl_rkaribqhbqhbqhbqhbqh_o{Մ͋Đ 0<EM&R2W=\G{`Qsd[l|iceyoj`xxn^wo\xo[xnZxmYxlXykXxkYwjZviZviZviZviZvics~чȎ.: CK#Q/V:}ZDv^NncXfga_mhZulXmWlVkUiUhTgSgS~hT|gT|gT|gT|gT|ggv؂͋ē*7 AI O,T7xYAq]KiaTae]ZlcVtgTgSfSeRcQbQaPaNbOcOcOcOcOcl{ӆɐ%3>FL(zR3sW=k[Fc_P\dXVk]Rt`Q`P^P]O[OZNYMZK[K\K\K\K\K\qۀ΋ĕ /:B{I#tN.lS8dWB]\JWbQRiVOsWNWMUMTLRLQKOJPIRGSGSGSGSGSwԆɑ)5 {>tEmJ)eO3^S@>@>@>@>ԇǔ{vq'k1 d9]?VD%OI-JO2FV6D_7Bj6Bv5AÄ4@Ò3@Ģ1?Ĵ0>/>.=0;2;2;2;2;2̐tj f`'Z0 T7M=HC#CJ'@R)>[*=f)3J2V2b2m2x2334455677888766!6"6"6"6"6"'06?B%A/>:;E9Q!8]!8i!8s!9} : :;;<<====>> =#=%<&<'<(<(<(<(,6?GK#J,G5C@@L">X$>d%?o$?y#@#A"A"A"A"A"B#B#B#C#C$C&C(B*B,B-B-B-B-B-2<G O S! S)P2L<GG!ES%E_'Ej(Es)E|)F)F)F)F)G)G)G*G*H*H+I,H.H0G1G2G2G2G2G27A O W[\& Y.U7RDNO%KY+Jc.Jm/Jv0J~0K0K0K0L0L0L1L1L1M2M2M4M6L7L7L8L8L8L8<G U]bc"a*_5 [AWK#SU-P^2Og5Op6Oy6O6O6P7P7P7P7Q7Q8Q8R8Q:Q;Q_H ZQ,WZ4Ub9Tk;SsU>U?V@UAUAUAUAUAUAUAC S_ glmnn/k<gFbO)^V4[^;Yf?XnAXvBX}BXBXBYCYCYCYDYDYDYEXFXFXFXFXFXFXFG Wc k o p rs,r:nDiL&eT2a[:^bA]jD\qF\yG[G[H[H[H\I[I[J[J[J[J[J[J[J[J[J[JK[gnrtwx*w8 sBoK#kR/gX9d_AafF`mI_tK^|L^M^M^M^N^N^O^O^O^O^O^N^N^N^N^NN_jpuxz}({6 y@uI qP,mV7i\@fbGciLbpOawPaQaRaRaSaSaT~aT}aT|aS|aS{aR{aR{aR{aR{aRQalsy|~%4}?zGvN)sU4oZ>k_FheLelQdsTd{V~cW|dW{dXydXwdXvcYtcYtdXtdVtdUtdUtdUtdUtdUTdnv|#2=~F{M'xS2tXv~]Go{aPhxfXbvl_^ttc[t~dYtdXtcWtbWtaVu`Ut`Ut_Vr^Wr^Wr^Wr^Wr^bp{˄(5?GM&R1yW;r[Dj_McdU]}j\X{raU{|bT{aT|`S|^R|]Q|\Q|\P{\Py\Py\Py\Py\Py\ftLj$2=EK#{P-tU7mY@e]I^bQXhXTq[R{\Q[PZPXOWNUMULWKWKXKXKXKXkÿ́Œ .9 B|IvN)nS3gW<`\DYaLTgQPpTN{TNSMRMPLOLMKMIOHPHQHQHQHQp~ȉ)5 }>vEoK%hP.aU7ZZ?T_FPfJMoLL{KKJJIJGIFIDHDFFEHEHEHEHEHw΄Ï#|0v: oAhG aL)ZQ1TV9O\>KdAImBHyAG@G?F=EA>A>A>A>~ȋ}xt*n4 g<aBZG"TL*NR1IX5F`7Ej8Dv7C6B4B3A1@0@/?1=3=3=3=3=3Ά“tmj!d-_5 X<RBLG"GM'DT*A],@g,?r+>*=(='<%;$;#:$8'8'8'8'8'Ǐ{nb]Y"U,O3 J:D@@G=O;X :b9m8z7̉7͘6ͪ5Ϳ4422222~rf\RLID(@0 ;78?5G4P3Z2e2r1ހ0ߐ/.-, *****ti]SJE @;6% 2, /3,;*C)L'W&b%p $ # " ! vj_TJA<7 3/ +! '' $. !5 = F P \ j z xl_TJA83/* &"  & - 5 > HTbq{naUJ@7/*%!  #+4>JVco{}}}}(%%(0<IVb n y                   &#"%.:GT`lv                      #",7DP]is}      ! " ! " ! ! !!!!!! !%()'4%@$M#Y#e#p#y$$%%&&''( ( ) ) ) )((((((($'.1&01.<,H+U+a+l+v,~,---../00011000/////#*18:#9,784C2P2\2g3r3{44556666777877766666)1; B D C)@3<>9J8W9b:m;w;;<<<<====>>>== =!="="="="/7 C JM L% I.D9AE@R@]@gAqAyABBBBCCCCC D D#C%C&C'C'C'C'C'4 > J RUT!Q) N4KAHLGW"Fa#Fk$Gs$G{%G%G%G%H%H%H%H&H&I&I'I)I+H,H,I-I-I-I-9 EQ X[[X#W1 T>QHNR$L\(Le*Kn+Lu+L}+L+L+L,M,M,M,M-M-M.N/N0N1M2M2M2M2M2= KW] ``__.];YEUN$RW+Q_/Ph0Pp1Pw1P2Q2Q2Q2Q2Q3R3R4R4R5Q6Q7Q7Q7Q7Q7Q7AQ[accef+d8 aC\K#YS+W[1Uc5Uk6Us7Uz7U8U8U8U8U9U9U:U:U;U;T;T;T;T;T;T;EU_dhhjl(k6 g@cI `Q*]X2[_7Yf:XnX>X?X?W?W@W@W@W@W?W?W?W?HXahlmoq&p3m>iGfN(cU1_\8]b<\i?[pAZxAZBZBZCZCZDZDZEZEZEZD~ZD~ZC~ZC~ZC~ZCL[dlprsu#u1r<oElL%hS/dY7b_=_eA^lD]sF]{G]G]H]H}]I|]Iz]Jy]Jx]Iw]Iw]Hw]Gw]Gw]Gw]GP^gotvv y!y/w;tCqK"mQ,iW5f\=cbBahF~`oI|`wKz`Ly`Lw`Mu`Mt`Nr`Np_Op`Np`Lp`Kp`Kp`Kp`Kp`KSakrwyz |}-{9 yBuI rO*oU3kZ;h_B{feHwdkLtcsOrc|PpcQocRmcRkcRicRhbSgcRhcPhcOhcNhcNhcNhcNVcnuz}}+7 }@zHwN'tS1qX:{m]AukbHqhhNmgoRjfxThfUffVdfVcfVafV`fV_fU`fS`fRafQafQafQafQYfqy~(5>F|L$yQ.}vV7vs[@pp_HjneOelkTbktW_j~Y^jY\kX[kXZkXYkWXjVYjUYjTYjSYjSYjSYjS]jt|%2<DK"P+x|U5rzY=kw]FetbM_rhT[ppXXpzYWpYVpXUpWTpVSpVRpURpTRoTSoSSoSSoSSoS`nxĀ"0: BIzN(tS1mW:f~\C`{`KZyfQUxnUSwxWRwVQxUPxTOxROxQNxPMwQMvQMuQMuQMuQMuQdr| ,7 @|GvL$oQ.hV7bZ?[_FUeLQmPOwQNPMOMMLLLKKJJKI~LH}LH}LH}LH}Liwǁ(4}=wDpJ!jO*cT2\X:V]AQdFNlILwIKHKGJEIDICHBGCFEEEEEEEEEo|‡#}0w: qAjHdM%]R-WV5R\;Mc?JkAIvAH@H>G=F;F:E9D:B4>4>4>4}Évpl#g/b7 \>VDPJ KO&GV*D]-Bg-Ar,@~+?*?(>'=&<$<%:'9)9)9)9)ȅ}ofa]'Y0S8 N>IDDJ@Q >Z"KW c n w    ')#(/%:#G"S"_ "j "s #| $ $%%&&'''(((( ) ) ((((($ * 1 3! 1*.5,B*N*Z+e ,o ,x - . . . . / / 0 0 0 0 1 11000000$+ 5 ;< ;& 704<2H2U3`4k5t5{6667777888888877777* 3 > DFD!@* ;5 :C;P;[>>>>>>??>>>>>>>0 ;F LMKG$F1 D>BJBUB_BhBpCxC~CCCDDDDDDED D!D"D#D#D#D#5BLQ R POP.N:KEIOHYHb Hj!Hr!Hy!H!H!H!I"I"I"I#I#I$J$I&I'I'H(H(H(H(:HQUUTWX*V7 SBPKNT#M]%Me&Mm'Mt'M{'M'M(M(M(M)M)M)M*M+M,M,M-L-L-L-L->LUY\\]_']4 Z?WHTP$RX(R`+Qh,Qo-Qv-Q}-Q.Q.Q.Q/Q/Q0Q0P1P1P2P2P2P2P2P2CQX_bbce$d2a=^EZM#XU*V\.Uc0Tj2Tq2Tx3T3T3T4T4T5T5S6S6S7S7S6S6S6S6S6GT\dgggj!i/g:dCaK!]R)[X/Y_3Xf6Wm7Vt8V{8V9V9V9V:V:~V;|V<{V{Y>yY?xY?vY@tY@sY@sY?sY>rY>rY>rY>rY>NYdkopprr+q6 n?kGhM%dS-aX4_^9}]d=z\k?x\sAv\{Bu\Cs\Cq\Do\Dn\Dl\Ek[Ek\Ck\Bk\Ak\Ak\Ak\AQ]hostsuv(u4s>pEmK#iQ+fV3{d[9wba>s`gBp_oEn_wFl_Gk_Hi_Hg_He_Hd_Ic^Hc_Gc_Ed_Dd_Dd_Dd_DT`krvwwyz&y2w<tCrJ oO)|lT1viY9qg^?ledDickHfcsJdb}KbbLabL_bL^bL\bL[bK\bJ\bH]bG]bG]bG]bGVdnuy{z|~#}0{: yBwH}tM&xrR/roW7ll\>fjaEbhhJ^gpM\gyNZgNYgNXgNWgMUgMTfLUfKUfJVfIVfIVfIVfIYhry}~ -8 ~@|FyzL#sxQ,muU4gsZ{EuJ o~O)i|T1bzX9\w]@WucGStkJPstLOsKNtJMtIMtHLtGKtFKsFJrFJqGJqGJqGJqGcpz&2|; vBpHjM%dR.^V5X[Is?H~>H=G;F:F9E7D8C:B;B;B;B;oz zv*q5k= eC_IYN$TS+NX1J_5Gh6Fr6E}5D4D3C1C0B/A/?1>3>3>3>3uÁxrn$i0d8 ^?XESKNP$IV)F^,Dg-Bq-A},A*@)?'?&>%=%<':):):):)||oh d`)[2V: Q@LFGLCS @Z#>c#=n#)G'Q&[%h$u#τ"ϕ ϨϾzmaUJ?5,$!$.8BMYgv }pcWLA6-%'0 ; FSbsseYMB7.%  (2>L[m~ugZNB7-$  )5CSdt"  " - 9 FS_jt}  + 7 D Q\hr{    ( 4 @ MYdox         % 0 = I V a k t|   " , 8 E Q]gqy!!!      $ ) * (( %3 #? "L"X"c#m$u$}%%&&''((())*** ) ) ) ) )  $/ 341".- +9 *F+S-^.h.p/x/~000111122 2 2 2 211111% /8< <:5&334A 5M 6X 6b 7k 7r 8y 8 8 8 8 9 9 999999999999+7?CB ?=>.=< =H=R=\>e>m>t>z>>???????@@??????0>EGFCFH*G7 EBDMCVC_CgDoDuD|DDDDEEEEEDDDDCCC7CINPMNQ'O4 M>KHIQIZIbIiIpIwI}IIIII I I!I!I"H#H#H$H$H$H$<GNUWUUX#W0T;QDOMNU M]"Md#Lk#Lr$Ly$L$L$L%L%L&L&L'L'L(L(L(L(K(K(K(@KT[^\[ ] ].[9 XBUISQ"QX%Q_'Pf(Pm)Ot)O{*O*O*P+P+O,O-O-~O.}O.}O-|O-|O-|O-|O-DNY`cb` bb+a6 ^?[GXN"VT'T[*Sb,Si-Rp.Rw/R/R0~R0}R1{R1yR2xR2vR3vR2uR2uR1uR1uR1uR1GS^dggefg(f4c=`E]K ZR'XX,W^/Vd1}Uk3{Us3zU{4xU5wU5uU6sU6qU7pU7nU8nU7nU6mU5mU5mU5mU5JWbhkkijk&j2h;eCbI_O&]U,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;hXf[>e[?c[?a[?`[@^Z@_[>_[=_Z<_Z;_Z;_Z;P_horrprs s-q7 o?lE|jK!wgP)qeU0lbZ6ha`;e_g>b_oA`_xB^_B]_B[_BZ_BY^BW^BW^AX^?X^>Y^>Y^>Y^>Tblrvvtv ww+u5s=}qDxoIrmO'mjS.ghX5bf^;^dd@[clCYcuDWcEVcDTcDScDRcCQcCQbBQbARb@Rb?Rb?Rb?Yfovyyxz{{(z3y; ywBtuHnsM$hqR,cnV3]l[:Xja?UiiCRhrDQh}EPhDOiCNiBMiALi@Lh@Lg@Lg?Lf?Lf?Lf?]jsy}}|~$0{~9 u}@o{FjyK!dwP)^uT0YsY7Tq_=Ppg@MpqBLo|AKp@Jp?Jp>Ip=HpkDeJ_~N%Y}S,T{X3Oy^8Lxf;Jxo}1>}1>}1nyxrn$j/e8_?ZEUJOO"KU'G[+Dd,Cn,By,A*@)@'?&>%>$<';(:):):)typi eb*]3X; SANGJMFS BZ"@b#>l#>x"=!< ;;::876 6 6 |vi`[X#U-P5L< GCCI?O3) ,=Nar    +8ER]gqy    (5BOZenw~    %2?KWakt{     ".;GS^hqx      )6C OZdmu|   !!%0=JU_iqx~  !""""!!! (+ *'#) 6!D#P%[&d'l't(z())))****++++++ + + + )031 -)!+0->.J0U0_1g1n1u2{22223333333 3 3 3 333%1785/ 46+797E 7O 8Y 8a 9i 9p 9v 9| 9 9 9 : : : : : ::::9999,7<@A<>A&@4?? >J>S?\?d?k?q?w?~??@@@@@@????>>>2<CIJGFI"I0G; EEDNDVD^DeDlDsDyDDDDDDDDDDCCCCC7@KQSPN PP,N7 LAJIIRHYH`HgHnHtH{HHHHHHHHG G G ~G ~G ~G <GQWYWTVV)U4 R>PFNMMUL[Kb Ki Kp!Kw!K~!K"K"K#~K#}K${K$zK%yK%xK%wJ%wJ$wJ$wJ$?LW]_]Z[\&[2X;UCSJQQPW"O^$Nd%Nk%~Nr&}Nz&{N'zN'xN(vN)uN)sN*rN*qN*pN)pN)pM(pM(pM(BQ[aca^_a$_/]9 [@XGVN TT$}RZ'{R`(yQg*wQn+uQv+sQ,rQ-pQ-nQ.mQ.kQ/jQ/iQ/hQ.hQ-hQ,hQ,hQ,GV_egebce!d-b7 `>]E~ZKzXQ$wVV(tU\+qTc-oTj/mTr0lT{1jT1hT2gT2eT3cT3bT4aT3aT2aT0aS0aS0aS0KYchkifg hh*f4d<bCz_Iv]N#q[T)mYY-jX_0hXg3fWo4dWx5bW6`W6_W7]W7\W7ZW7ZW6ZW5ZW4[V3[V3[V3O]flnljk ll(k2i: {gAvdGqbL"l`Q(h^W.d]\2a\c6^[k8\[t9Z[~9Y[:W[:V[:UZ:TZ9SZ9TZ7TZ6TZ5TZ5TZ5Tajoqpmopp%o0}n8 wl?rjEmhK hfP&cdU-^bZ3Za`7W_h:U_q;S_{}$>|#<{%;y&;x';x';x'mwwpj fb)^2Y: T@PFKKGQCX!A`#?i#>t"=!< <;::87777t~sib]Z#V.R6N= ICEIAO>V<^:h9s98765543222{|pdYS PM'J0F8B> >E;L8S6\5e4p3}211 0 . . - ,,,wk_TIDA?(<1885?3F 0N /W .a -l ,y+*('&%$###}rfZNC820/&-/*6(>&G%P$Z"e!r xmaUI<1(  )2;DOZgv sfYMA5*! (3>JWfv͈͚̮wi\PD8-#  !+7DScu߇߬߻zl_RF9.#  #/>N_r~pbTH;/$  '7HZl|  )6COZenv}  &3@LWbksz  #/=HT_hpw}   +8DP[dmtz    '3@LV`ipw}  !- 9 F Q [dlsy!%2@LW`hou { !!!"""####$$$$"''#"-%;'G(R)[)c*j*q*w+|+++,,,,,,---,,,,*-10**.'051B1L2U2^3e3l3r3x3~3344444444 4 3 3 3 3 '08<<869#909<9G 9P 9X 9` 9g 9m :s :y : : : : : : : : : ::9999-6@FFB? BB,A7@A ?K ?S?Z?a?h?n?t?{??????????>>>>1>HNOJGII(H3F= EFDNCUC\CcCiCpCvC}CCCCCC}C|CzCzByByByB5EOTUQMOP%O0M9 JBIJHQGXG^GeFkFrFy~G}G{GzGxGvFuFtFsFrFrFrFrF<KTYZVSTU!T-R7 P?NFLMKSJZ}J`{JgyJnxJuvJ}uJ sJ rJ!pJ!nJ"mJ"kI#kI"jI!jI!jI jI APY^^[WXYY+W4 U<SC~QJ{OPxNVvM\!tMc"rMj#pMq#oMz$mM$kM%jM&hM&fM'eM'dL'cL&cL%cL$cL$cL$FT]ba_[\ ]](\2Z: }XAyUGuSMrRR!oQX#lP_%jPf'hPn(gPv)eP)dP*bP*`P+_P+]P+\O+\O*\O)\O(\O'\O'KX`edb_`aa%`/~_8 y\?uZEpXJlVO!hUU%eT[(cSb*aSj,_Ss-^S}.\S.ZS.YS/WS/VS/UR/UR-VR,VR+VR*VR*O\dhgfbdee"e-zc6 ua=p_Ck]Hg[M!cZS&_XX*\X_-ZWg/XWp1VWz1UW1SW1RW1QW1PV1OV1OV/OV.PU-PU-PU-S`gkjifghj{i*vh3qf; leAgcFbaL^_Q%Z^V*V\\.S\d1Q[m3P[w3N[3M[2L[2K[1J[1I[0IZ0IZ/JY.JY.JY.Xckmmljkm {nwn'rm1ml9 hk?ciE^gJYfO#UdT)QbZ-Nab1Kak2Jau2Ia2Ha1Ga0Fa/Ea.Ea-D`-D_-D^-D^-D^-\hopppnp{qvrrs$ms.hr7dq=_oCZnHUlM PkR&LiY*Ii`-Ghi/Ehs.Dh.Dh,Ch+Bh*Ah)Ah(@g)?f*?e*?d*?d*alsttss|uvvpxly hy+cx4_w; ZvAUuFPsKLrQ!HqW&Ep_(Cph)Apr)Ap~'@p&?p%?p$>p#=p"yq!=y} @D 3* '%#("0 8AJT_ky |qeZOD8-# !* 3 = GR_m}wl`UI=1& %.9DP^oĀĒĥø~sfYL?3(  '2>L\oւַ֧֕wi\OB5*  +8GXl{m_QD7+   #2BTfy'3@MXbkry~ $0=IU_hov|   ,9FQ[dlsy~  (5AMW`hou{#/<HS\dkrw|   (6BNW`gnty~   / <HR[cjpv{)7C N!W!^"e"l"r#w#}###$$$%%%%%%%%%")-+%!&$(2)>*H+R+Y,a,g,m,s,y-~--------------!+5983- 12,283C3L3T3\3b3h3n3t4z444444444 4 4 4 3 3 &5>BA=8:;(:3:>:G9O 9W 9] 9c 9j 9p 9v 9} 9 9 : : : : : : }9}9|9|9|9.=FJHD@AC$B/@9?B ?J >R >X>_>e>k>r>x>>~>}>{>z>x>w>u>u=t=t=t=5DLPNJFGI H+F5E> CFCMBTBZB`~Bg|Bm{BtyB|xBvBuBsBqBpBnBmAmAlAlAlA<IRUSOLL NN(L2J; IB~GI|FOzFVxE\vEbuEisEqqEypEnEmEkEiEhEfEeEeEeDeDeDANVXWTPQRR%Q/P8 |N?yLEuJLsIRpIXoH^mHekHmjHuhI~fIeIcIaI`H ^H ^H^H^H^H^HFRZ[ZXTUVW"V-|T5 xR<sPCpOIlMNiLTgL[eLacLi bLr!`L{"_L"]L#\L#ZL$YK$WK$WK#WK"WK!XK XK JW^^][XYZ[}Z*xY3sW: oU@jSFfRKcPQ`PW!^O^#\Of$ZOn%YOx&WO&VO'TO'SO'RO'QN'PN&QN$QN#QN#QN#OZaa`_[]^}_y_(t^1o\8 jZ>fXDaWI^UNZTT"WS[%USb'SSk(RSu)PS)OS)NS)MS)KS)JR)JR(KR&KQ%KQ%KQ%S^ddcb_a}b yctc%pb.ka6f`<b^B]\GY[MUYR"RXX&OX`)MWh*KWr+JW~*IW*HX)GX)FW(EW(EW'EV'EV&EU%EU%Wbfffeceyfsgoh"kg,gg4be; ]d@YcFUaKP_P!M^V%J^^(G]f)F]q)E]|)D](C]'B]&A]%A]%@\%@[%@[%@Z$@Z$\eiiiigzitknljmfm)bl1]l8 Yj?UiDPhILfOHeU"Ed\%Cde&Ado%@d{%@d$?d#>d!=d!=d ;9$6,441;/B-J+R*[)f'r&%$"! ~si]RI>4.,*$(,'4%<#D!M VamzyncYMC8.$  )1:CMW d q ti^SH=2( $-7AKXeuzodYNC7," )3>IWfxvj_TH;/$ %/:FVgzύϟϰϿ}rfXK>1&(5CTf{xj\NA3'.>Pdx $1>JU^gnuz    -;GR[dkrw|  )7CNX`hoty~%1>IT\dkqv{ ,9EOX`gmsx| %3?JS[cioty~ +9DNW ^ e k p v {    %3?IRY`flrw}&)& -":"D#M#U$\$b$h$n%s%y%%%%&&&&&&&&&&)252-% (+(+4,?,H,P,W,^-d-i-o-u-{--.........--%3;=:7114#4/3:3C3K3R3Y3_3e3k3q3w4444~4}4|4z4y4 w4 w3 v3 v3 .;CCB>:9;;+:59>9F8N8T 8Z 8` 8f 8m ~8s |8{ {9 y9 x9 v9 u9 s9 r9 p9 o8 o8 n8 n8 5BJIGDA? AA'@1?:>B =I ~=P |=V z<\ y yBE wAKuARs@Xq@^o@en@ll@tkA|iAgAfAdAcAa@`@`@`@_@_@@MQQPMJJKL K*{J3wH: sFApEHmDNkDTiDZhDafDhdDpcDyaD`D^D]D[DZDYCYCYCYCYCEQTTSQNNOP{P(vN0rM8 nK>jJDgIJdHPbGV`G]^Gd]Gm[GvZGXHWHUGTGSGRGRFRFSFSFJUWWVTQRS zTvT%rS.mR5iP< dNAaMG]LM[KSYKZWKaVKiTKsSK}QKPK NK MK LJ KJLJLILILINXZZYXTV{WvXrX"mX+iV3dU: `S?\REXQJUPPSOWPO^ OOf!MOp"LO{"KO"IO"HO!GO!FN!EN FNFMFMFMR\]]\[X|Zv[q\m]i\)d\1`Z8 \Y>XXCTVHPUNMTTJT[!HSd"GSn#FSy#ET"DT"CT!BT AS @S@R@R@Q@QW____^\x^q_lagadb&`a/\`6W_< S^AO\GL[LHZSEYZ CYb!BYl!AYw!@Y ?Z>Z=Z FjCBiI?iOz8:z>7zE 5zL 3yT 1y\ 0yg /yr .y -y ,x+x*x*w)u(t (s (s oppp~qusju_yV{N~E?<:$8,543;1B.I-Q+Z*d)p(|&%$#""~!}!|!|sttu{vqxf{ZQH?51/-%,-*5(=&D$M#V!` lxxxyzw{l~aVLC9/&" %-5=FOZer  }}~}rg\RG<3) " * 3<FQ\ixxmbWLA6,"  (1;EQ^m}~sg\QF;0&  $.8CP_pynbWLA5*  )4@O`rɆșȪǹui^SG9-! $0=N`t߳߳|qgYK=/# ,:L_s   !/;GR[ckqv{  +8CNX`hnty}&3?JT]dkpuz~ ".;FPY`gmrw{)6AKT\cinsw|#0<FOW^djoty~ (5@JRY`fkpuz  ! / : D MU[aglrw} #$  )5?HPW]chntz'/.+' "#$0$:%C%K%R%Y%^%d%j%p&v&}&&''''}'|'{'z'y'y'$17641,(+,*,5-?-G-N-T-Z-`-f-l-r-y}-|.{.y.x.v.u.s.r.q-q-q--9==;841 23&303:3B3I3P~2V}2\{2az2hx3nw3vu3~t3r3q4o4n3l3k3 j3 i3 i2 i2 4@BBA>;89:"9,95}8={8Ex7Kw7Qu7Ws7]r7d p7k o7r m8{ l8 j8 h8 g8 e8 d8 b8 b7 a7 a7 a7 :FFFEB@>>?~?(z>1v=9t<@ qS>T>T>ELMMMJHG}H xItI"pH+kG3gF: dD@ aDF^CL\BR[BXYB`XChVCqUC{SCRCPCOCNCMBMBMAMAMAIOPPPNK~KxLsMoMkM)gL0bJ7 _I= [HCXGHVFNTFURF\QFeOFnNFxLGKGJGHGGFFFGEGEGEGEMRSSSQNyOsPnQjRfR&bQ.^P5ZN; VM@SLFPKLNKRLJZJJbHJkGKvFKEKCKBKAK@J@JAIAIAHQUUUUT|QuSnUiU eVaV#]V,ZU3VT9 RS>NRDKQJHPPFOWDO_BOiAPt@P?P>P=PU^=UhGPZer qqqyrotdwZ{OF<3*! %-6> H R^kyvv~vuxj{_UK@6-# %-6?JVcq{{{|peZPE:0&  #+4?JWfvvk`UJ>4)  (2=JYiz|qfZOD8.# $.:IZl’¤xlaVK?3( *7HZnقڔ٣ٮٳti^SG9+'5GZn,8DNX`hnsx|(5@KU]dkpuy} #0<GQYaglqvz~+8CLU\cinrw{ &2>GPX^djnsx| ,8BKSZ`ejoty~ %1<EMU[afkpuz  *6@HPV\bglqw}    $0:CKRX]chntz~}}||%('%!*5>FMSY_djpw}|z y x v u!t t s $.00.+&! "$%%0%9%B&I&O&U&[~&`|&f{&my&tx'|v'u's'r'p(o(n(l(k'k'k',46652/**+!,+,5~,=|,Dz,Ky,Qw,Wv,\t,cs,iq-pp-xn-l-k.i.h.f.e.d-c-c-c-39;<:85112}2'z20w28u2@s2Gq1Mo1Sn1Yl1_k2ei2mg2uf2d3c3a3`3^3]2\2 \2 [2 [1 :>?@?<:77 {8w8#t8,p74n7<k6Bi6Ig6Of6Ud6[c6ba6j `6r ^7| ]7 [7 Z7 X7 W7 U6 U6 U6 U5 U5 ?BCCC@?<z<v=r= n=)j<1g;8d;?b:E `:K ^:Q ]:W [:^ Z:f X:o W;y U; T;R;Q;O;N:N:N9N9N8CEFGFDB{@uAqAmBiB&eA.a@5^?; [>A Y>G W>M U=TT=[R>cQ>lP>vN>M?K?J>I>H>G=H=H<H<FHIIIG|EvEpElF gFdG#`F+\E2YD8UC> RBC PBJNAQMAXKB`JBiIBsGBFBEBCBBBABAAAAB@B@IKLLLKyHrIlJgJ bK_K [K)WJ0TI6PH; MGA KGGHFNFFUEF]CFgBFqAG}@G>G=G ARD>RJ;RQ9QZ8Rc7Rn6Rz5R5R4R3R2Q1P1O1N1NRSTU~UuUjTbV\XWYRZ N[K[ I[(F[/BZ6?Z< /hE-hL+hU*h_)hj(hv'h&g%g$f#f"e"c!b!a\]^|_r`ia]cVeOhGj?m7o4o1p0p$.p,,p3*p:(pB&pJ%pR#p\"pg!pt poonmlkjiaabxcndeeZhRkJnBp9s1u*w 'x%x$x&"x.!x6x>xFyOyXycxpx~xwvutsrqee~ftgkhajWnMqEt2'  !/AUj}(5ALU]djpty} $1=HQYaglqvz~ -9CMU]cinrw{(4>HQX_ejnsw| #.9CLSZ`ejosx})3=FNU[`ejoty~ "-7AIPV\afjou{ &1;CKQW\aflqw~~  +5> F L R X ] c h n u | ~ } { z ywvvv!! %/9AHNTY_~d}k|qzyywutsqponmm#'))'%! *4<~C|J{PyUw[vaugsnrvp o m l!j!i!g!f!e!e!e *./0.,)%"#}$&z%/x%8v%?t%Fs%Lq%Ro%Wn&]l&dk&ki&sh'|f'e'c(b(`(_(^(]']']'/35532/,~* z*w+"s++q+3o+;m+Bk+Hi+Nh+Tf+Zd,`c,ha,p`-y^-]-[-Z-Y-W-V-V,V,V,4799864|2x0t0p1m1'j1/g17e0=c0Da0J`0P^0V]0][1dZ1mX1vW2U2T2S2Q2P1O1O1O0O08:<=<:|9w7s5o5k6g7$d6,a53^5:\5@Z5FX4LW4RU5YT5aR5j Q5t P6~ N6 M6 K6 J6 I5 H5 H4 H4 I4 ;>?@@=x<s;n:i; e;b; ^;([:0X96U9<S9BQ8H O8O N8V M9^ K9g J9q I:| G: F: D: C: B9 B9 B8 B8 B7 ?ABCC{Au?o>i?d?`@\@Y@&V?-R>3O=9M=? K=E I=L G=S F=[D=dC>nB>z@>?>>>=><=;=;<<<<;BDEFFxDqBjBdC_D[DWETE#QD*MD1JC6GB< EBC CBI ABQ?BY>BbN9;N? 8ME 6MM 4MU 3N^ 2Ni 1Nu 0N /N /N .N -M ,M ,K +J +I JLMNvOmOdO[PTROSJTFUCUAU">U*;U08U75U=3TD 1TK 0TT .T] -Uh ,Ut ,U+U*T)T(S(S'Q&P &O NOP|QrRiR_SVUPWIXDZ?[ <[9\7\'5\.2\40[;.[B,[J+[R)\\(\f'\r&\%[$[#Z"Z"Y!X!W VQSTxUnUeV[XSZL\E^>`8b4b1c/c#.c*,c1)c8(c@&cG$cP#cY"cd!cp c~cbba`^]]UVWtXjYaZW]O_HaAc9e1h+j (j&j$k%#k-!k4 k<kDkMkVkakmk{jjihgeedYZ{[p\f]^_TaKdDfGNU[`ejosx}%/9AIPV[`ejoty)3<DJQV[`ejou{ #-6>ELRW\afkqx~}|{yyy  '09@GMRX]bh~n}u{}zxwutrqppo ! * 3 ; B~ H} N{ Tz Yx _w evltsr|qonlkihggg ##" ~%|.y6w>vDtJsPqUp[namhkpjyhfecba`__^#&)(('$ }zw t*q2o9n@lFkLiRgXf^dec ma v` ^!]![!Z!Y!X!W!W!W!(,..-,}*y'w#s#p#m$&j$.h%5f%<e%Cc%Ia%N`%T^%[]&b[&jZ&tX'~W'U'T(S'Q'P'P'P&O&-0222~0x/t-q*m) i*f*"c**a*1_*8]*?[*EZ*KX*QW+XU+_T+gR,qQ,{O,N-M-K-J,I,I+I+I*14566z4t3o1k/g/c/`0]0&Z/.X/4V/;T/AR/GQ/MO/TN0\L0eK0nJ1yH1G1F1D1C1B0B0B/B/4799}9v8p6k5f4b4^4Z5W5#T4*R41O37M3=K3CJ3JH4QG4YE4bD5lC5wA5 @5 ?5 =5 <5 ;4 <4 <3 <3 7:;=z=s<m:g8a8]9X9 U9R: O9'L9.I84F7:E8@C8GA8N @8V >9_ =9i <9u :: 9: 89 79 69 59 58 67 67 :=>?w?o?i>b;]=W=S> O>M?J>%G>+D>1A=7?=>==E ;=L 9=T 8>] 7>g 5>s 4> 3> 2> 2> 1> 0= 0< 0< 0; =?A~BtBlBeA^@XARBNCJCGDDD"BD)?C/O :O8P6P$3P+1P1/P8-P?+PF*PO(PX'Pc&Po%P|$P#P#O"O!N M L KGIJtKjLaLYMOOIPCR=T7U3V1V/V -W(+W/)W6'W=%WD$WM"WV!Wa WmWzWVVUTSRQJL{MpNfO^PUQLSFU?W8Y1[,] (]&]$^$#^+!^2 ^:^B^J^T^^^j^w^]]\[YXXNPwQlRbSZTRUIXBZ;\3^,a$ceeee&e.e5e=fFfPfZef es e ddca`_ _R~TrUhV_WWXNZE]=`6b.d&gjlmm m m( m0 m8mAmKmUmamnl|lkkihgfWyXmYdZ\[S]J`Ac8f0i(k nqsu vvu"v*v2v;uEuOu[uhuwttsrqpo[t\i]a^X`OcFfEKQV[`ejpv}~~~ )19@FLQV[`flr~z|{yxwvutts ",3;AG~M}R|Wz\ybwhvouwsqpomlkjji  &|.z6x=wCvHtNsSqYp_oemlluj~hgedcb a ` ` ~ { w u )s 1q 8o?nElJkPiVh\fcdjcsa}`^][ZYXXX "##!zwuspm$k,i4g:eAdFbLaR_X]_\g[pYzXVUSRQQPP!%'((z'u%q"nl if c(a0_6^=\C[IYOWUV]U eS nR!xP!O!N"L"K!J!I!I!I &)+,|-u,p)l'h%e#b#_#\#$Z$,X$3V$9U$?S$ER$KP%RO%ZM&bL&kJ&vI'H'F'E'D'C&B&B&B%*-/0y0q0l.g,c*_)\(Y)V)!T)(Q)/O)5N);L)BJ)HI*OH*WF*_E+iC+sB,A,?,>,=,;+;+<*<*.02~3u3n3h2c/^.Z.V. S.P.M.%K.+I.1F.8E.>C.EB.L@/T?/]>0f<0q;0}91807060505/5.5.135{6r6k6d5_2Z2U3Q3M3J3H3"E3(B3.?24>2;<3B;3J:3R84Z74d55o45|35251504/4/3/302368x9o9g9`8[6U6P7K8H8 E8B8?8&<8,:8288868?58G38O29X19b09n.:z-:-:,:+9*9*8*7*669;u<l<d<]<V;P;K<F=B= ?><>9>#7>*5>02>61>=/>E.>M,>V+?a*?l)?y(?'?'?&?%>$=$<$;9<}=r>i?a?Y?R?J@EAABEKPUZ^ciou} !*29@FKPUZ_djqx}|{zyyyy$-4;AFKP~U}Z{`zfylxtv}usrqpoonn '}/{6z<xBwGvLtQsVr\qboinqlzkihgfeedc  |zw!u)s1q7p=nCmHlMjSiXg_ffdncwb`_]\\[ZZ|yvuspm$k,i3g9f?eDcJbP`V_ \] d\ lZ vY W V U T R R R Q }vroml i f d'b.`5^;]A\GZMYSWZUaTjRtQONMKJJJJ"#x#q"l hfdb_\#Z*X0W7U=TCRIQPOWN_LhKrI~HGEDCBBC"%|'t'm'g%c"` ]Z XUS&Q-O3N9L?KFIMHTF\E fD!pB!|A!?">"=!%c<&n;&z9'8'7'6&5&4%4%5$&)+v-m.e._-Z+V(R'N(K'I'F(D(&A(,?(2=(8<(?;)G:)O8*W7*a5+l4+x3+2+1+/+.+.*.)/)),}.s0j1b1[0V/R,M,I-E- B-@-=-":-)8,/6-55-<4.D3.L2/U0/_/0j.0v-0,0+0*0)/(/).)-,/{1p3g3_4X3R2M0H1D2@2<29272 52&22,133/3:.3B-4J+4S*4])5h(5u'5&5%5$5#4#4#3#2/2x4m5d6\6U6N6H5C6>7:768 3818/8$-8*+91)98(9@'9H&9Q$:[#:g":s!;!: ::997725u7j8`9X9Q9K9D:=;8<4=0= ->+>)>!'?(%?/$?6"?>!?F @O@Z@e@r@@@?>>=<6~8q:f;]<U<N<G=@>9@4A.B*C'D$E"E!E%E,F3F;FDFMFWFcFpF~FEEDCBA9z<n=c>Z?R?K@D@I6K/N(P!RTW Z ZZZ!Z)Z0Z9ZBZLYWYdYrYXXWVUTyElGaHXIPIIJBK:N2Q*T#VY[ ^`aabb$b+a3a=aGaSa_am`|`_^]\\tJgK]LTLMMFN=Q5T,X%Z]` cegh hijj&j.j7jAjMjYjgiwhhgffenObPYPRPJQAU8X/\&_behjmoopqrs s't0t:tFsSsasqrqpppohS^TVTOUFX<\2`)dhk nqsvwxyz{|} ~(1=KYi~{}|{{{cX[YTYJ\@a5e,j!mquxz}  '3BQas`]Y^OaDe9j/o$tx| (7HXi}_bTfIj>p2u'z '8J\pZkOoDu8{, *=PezUtJz>2% .DZoтҒҟ&0:CKSY_dinrw} !,6?GNTZ_dimrx~'1:BIOUZ_dhmsy#,5=DJPUZ^chmsz '/8?EKPTY^chnt|"+2:@FKPTY^ciow~~~~ %-4;AFKPTY^~d|k{ryzyxvutssss (/~6|<{AzFxKwPvUuZs`rfpnovnmljiihhh~{yw#u*t1s7q<pBoGmKlQkVi\hcfjesd~ca`__^^^ {xvs qom%k,j2h8g=eBdGcMaR`Y__]g\q[{YXWVUUUT ztp m ljhec'a-`3^9]>\DZIYOXVV]UeSoRyQONMLLKK|tmifdca^\"Z)X/W5U:T@S FQ LP SN [M dK nJ yH G E D C C B C xohc_][Z W US$Q+P1N7M=KCJJHQGYEbDlBxA?><;:;;~ t!k"d"^ ZWUSQNL J'H-F3E9C@BGAN?V=`<j:v98654344!{#p%g%`%Z$U"R OLJ GEC#A*?0=6<=;D9L8T6^5 h4!t2!1!0!/!- - -.#x&m(d(\(V(Q&M$J"G!C!A!>!,)G*)P)*Z(*d'+q%+~$+#+"*!*!)!)!(%~)r+g-^.V.P.J-E,@+;,7,4, 1,/,-- +-')--(-4&.<%.E$/N#/X"/c!0o 0}00//.--){,o.d0[1S1L1G0A0;06121.2+2)2'3%3$#3+"42 4:4B4L5V5a5n5{5544322,x/l1a2X3P3I3C3=46506,7)7%8 "8 99"9):0:7:@:J:T:_;l;z;::9 877/u2i4^5U6M6F6@7:729-:(;#=>???@&@-@5@=@G@Q @\ @i Aw @@?>== <3q5e7[8Q9J9C9=:7;/=*>%@BDE FF F# F* F1 F:FCFMFXFeFsFFEDCBB{7m9a:W;N<G<@=:=4?,A&C EGI L MMM M&M.M6M?MIMUMaMoM~LKJIHHv;h=]>S?K?D@>@7A0D)F"HKMORSTTT#T*T2T;TETQS]SjSzSRQPONp?dAYBOBHCBC;D3G,I$LOQSVYY Z[[\%\-\6\@[K[X[f[u[ZYXWVkC_EUELFFF?G7J/M'PSVX[^`` abcd!d(d0d:dFdSd`dpcba``_eHZIQIJICJ:M2Q)T!X[^ acfhij klmn"o)o3o?oLnZnim{lkjji_MVMOMHN>Q5U,Y"]adgjloprst uvxy#z+z7zDzSybytwvuut[RTRMRCU9Z/^$bgknqtwy{|} "+9IYkXVRWHZ=^2d'imrvy| !.>PbuW[M_Bd6i+oty}"2FXkRdGi=<<<;zof_ZVTRQ OMKI%H+F 1E 6C <B C@ J? R= [< f: q9 ~7644 3 2 2 vkb[UQNLJI GDB!A'?-=3<::A9H7P5Z4d2p1|0.-,+++~rg^ W QMIFDB@=;9$7*50463>1F0N/X-b,n*{)'&%$$%{o!d"[#T#N"I!D A>;8 642 0&.--4,;*C)L(V&`% l$ y" ! y!l#a%X&P&J%E%@$<#9!5!2!/!-!+!(!#'!*&"1%"9$#A#$J!$T $_%k%x%%%$##" v#i&^(U(N(G(B(<'8'3&0&,&)& &&$'"' !'' (.(6)?)H)R*]*i*w***)(('"s&f([*R+K+D+>+9*4*/**+&+#, ,---%.,.4.</F/P/[/g0u0/ / . - - ,}%p)c+X-O-H.A.;.6-0-*/%0!112 334"4)414:4C 4M 5X 5d 5r5443221z(l,`.U/L0E0>08030-1'3"4578 9: : :' :.:6:?:J:U:a:n:}:98876v,i/\1R2I3B3;35303*5$78:< > @@@@$@+@3@<@F@Q@]@k@z@?>==<r0d2X4N5F6?69636-7'9 ;=?BDE FGG G'G/G8GBGMFYFgFvFFDCBBm4`6T8K8C9<9791:*<#>ACE HJK LMNO$O+N4N>NINVNcMrMMLJIHh9[:P;G<@<:<4=-?%BEGJ LNQR STUV W'W/V9VDVQV_UnUUUSQPb=V>L?D?>?8@0C(F ILN QSVXYZ \]^_"`*_4_?_K_Z^i^z]]\ZY\BQCICCCELQV[_chnt{  )19AGLQVZ_diou}$,4<BHMQVZ_djpx '/6<BGLPUY^dkr{")07<BGKPTY}_|f{myvwusrsssrr ~}$}+|1z7y<x@wEuJtOsTrZp`ohmqk{ihggffff}ywtsrq%p+o1m6l;j?iDhJgOeUd[ccal_v^\\[[[ZZxspmj igf e&d,b1a6`;_?^E]J[PZWX_WgUrT}RRQQPPPxpjfda_ ]\[!Z'Y,X2V6U;T@SFQLPSO[MdLnJzIIHGGFF{qhb^[YWVTSQ#P(O-N2L7K<JBIIGPFXDaClAwA@?>=>> u kb\W T QPO MKJH$G)F.D3C9B>@F?M=U;_:i9v8765555 }qf]VQMKI HF ECA ?%>+<0;6:<8C7K5S3]2i1u0/----- ymbYRMHEBA @ ><:8!6 '5 -3 32 :1 A/ I. S, ]+ i)v'&$$ # " " vi^UNID@<:97 531/$.*,1+8)@(H&R%\#h"u sf[RKE@;7430. ,*( &&$-#5"=!FPZfs~pcXO H B < 730-*'$" #+2;DNYer {m` U"M#E#>#9"4"0!, ( $ !  !!!!"("0#8#B#L$W$c$p %~ $ $ #"" !xj ]#R$J%B%;&6%1$,$($#$%%& '''(&(- )6 )? )I )T)_*l*{*)('&&u f#Z%O'G(?(8(3'.')'%' ()*,- - - .#.*.2/;.E.P.\/i/x/.-,++q#c&W(L)D*<+6*0*+*')"*,-/13 334 4'4/484B4M4Y4f4u432110m'_)S+I,A-9-3-.-*,$-.024 68 99::$:,;4;>:I:V:c:r::8765i*[-O.F/=0601/,/'0!1357 :<= ??@A!A)A1B:AFAR@`@o@@@><;d.W0K2B3:343/2*3#479; >@BDE FHII%I-J6IAINH\HkG|GGEDB_2R4H5?68635-6&8:=@ BEGIKL NOQR R(R2R<QIPWPgOxOONLKY7M8D9<97819);!>AD GJLOQRTV WY[\$\-[7ZCZRYbYsXWWWTS<I<A=;<5<,?$BFJ LORUWY[]^` bdef'f1e=dKd\cnbaa``N@F@?@9@0C'GKO SVY\^acefhik noq q*q6pDpTofnymlkkKEDD>D4H+L!PU Y]`cfilnoqstvx z|"-~;~K}^|q{zxwIICH9L.Q$V[ `ehlosvxz|~ "/@Rg|HM=Q3V(\aglrvy} "3G\pCV7[,bhntz &;Qf{=a1g%nu { .G[p̃ɖ%.7?GMRX\afkpv}  *3;BINSX\afkqx%.6=CINRW[`elrz  (07=CHMRV[`fmt~#*17=BFKPUZ_fnw}{zxxyyx $+17~<}@|E{IzNxTwZv`thsqq{omlkklll}zxwuu&u,s1r6q;p?oDmHlMkTj[hcfkdvca`____`zuqnk jii i&g,f1d6c;b?aD`I_N]V\^ZgYqW|UTSTTTTxpjgca` ^]]!\'[,Z1Y6X:W?VDTJSPRZPbNmMxKJIJJJJyoga]ZXV UTSS"R'Q,P1O6M;L@KFJLHUG^EiCtA@AAA@@~sh_YURPNM LKJI#H(F-E2D7C<AB@I?Q=[;e9q8688777ylb Y S NJHGED BA@?#=(<.;3998?7F5O4X2c1o0}0//...t h ] UNH D A ?>< ;9865$4*2/150<.C-L,V*a)m({''&%&&p dYPID?;8 6 54 21/.!,&+,)2(9'A%K$U#`"m z{ m`VMF?:630.- , *( & % ## )" 0! 8 A J U an}    xi]RJB<62.+)'%# ! '/7@JT`m{    ufZPG?83.*'$!$,5>HR ^ j xrcWMD<50+'#  " ) 1 : DNZguo`TJA 9 3 -($   ! !!"&".#6#@#K#W#d#s$#"! k]Q G!>"6"0"+!&!"   !" $ & &'''#(+(3)=(H(T(b(p()'%$$hZ N"D$;%3%-$($$# ""#%' (+ ,---!.(.0/:/D.Q-_.n-~..,*)d!V#J%@'8'1'+&&&"%%&(* ,.01 3445%5-565A5N4\3k3{3310._%R'G)=*5*.)))%( ()+- 02467 9:;<"<*<3<==I;X:h:x99975Z(N+C,9-2--,(+#+-/1 468;<> @ ACDD&D/D:DECTBd@u@@@?=U-I.?0600/,.&.035 8;=@BDEG IKMM"M+M5MALOJ_IqIHHHGP1E2;343/1)2"47: =@BEHJLNOQ SVXX&X0X;WHUYSlRRQQPJ6@69635-5%8;? BEILNQSUWY[] _bc c*b6bC`S_f]{\\[ZF:=:7929)<@D HKORUXZ]_acegi lno#o/n<lLk^jsihgfB><=6=-@#EINRVZ]`begikmprtw z||'{5zDyVxkwvtsAB;B1E'JOTY^aeilortvxz|~ *:L`vAF6J+P U[`fkosvz},?Tj;O0U%[a hnty}2G^s5Z)ahnv|$;Sh}ȏ "+4<CJOUZ^chnt{&/7>DJOTY]bhnu} !)18>DHMQV[agnv#+28>CGKOTY`hoy|{ %,28=AFJNSY`}i{rz}xvtsrqpo~}}}&{-y2x7w<v@uEsIrNqTpZoamlkwigfedcdc~ytrp onn!n'm,k2j6i;h?gDfIeOcUb\ae_r]~[YWWWXYyrkhecb bbb"a'`-_2^6];[?ZEYJXQWXU`TkRyPNLKKNNyofa]ZYX WWWW"U'T,R1Q6P:O@NELLKSJ\HfGtECA@@CD}qf^WSQONM MLLK"J'H+G0F5D;CAAH@O?X=b<p:~8779::vj_VPLIGEDC BBA@">'=+;0:68=7D6L4U3^2m1z0/.012~pdYQJEA>=;: 98753"2'1,01/8-@,H+Q*\)i(w'''(((zl_TL E ? ;75320 /.-,*#)((.'4&=%E#O"Z!g u vg[ P H @ : 5 1 . ,*)( '&$#"% + 2:CMXesrd W MD<61-)& $ " !  "(/8ALWdrn ` TJA93-)%!       & . 7 A L X dr    k ]QG=6/*%!    $ , 5>ITao~hZND:3-'"   !(1;EQ^m}eWKA80*$   &.8CN\k{bTH>5.'"   !!!#"+"5#@#L"Z"i"y!!!^QE:2+%   "$ & ''(!()(2(=)I)V'g&x&&&$"ZMA 7!/!(!#  !#%'*, .../&///:/F0S.d,v,,++(VI!>#4$,$&#""! !# %'),.02 4566$6,777B7O6`4r22111Q#E%:'1'*&%%!$#%' )+.0357:< >?? ?(?3?>?K?ZACEHJLN QSS S)S5SBRPOdMxKJJIB08100,.&.147;>ADGJLOQSUWZ ]__$_/^<^K\\YrWVUT=45402*2!59<@DHKNRTWZ\^`cfi lnn'm5lCjTgjecba:847/6%9>CGKPTWZ]`begilnqtx {| {-z<xLvatxrpo9;4;)>CIOSW\_cfiloqsvx{} $3DYp9?.C#IO U[`dhlptwz} (9Mc{3I(NT[bhmrw{ +@Vm-T![ahov} 1H`uƈ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ6;?=EcJMϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:?=DcILϱjȮǮǮǮƮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ5:>C5HWP|X_ѭtǬǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ0>C4GWP|X^ѮrǭǭǮǮƮƮƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ1>B4GWO|W߳]ѯoȭȮǯǯƯƮŮŮŭŭŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN|Vߴ\ѰkȭǯǯƯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1=B3FVN{UYӳcȮ~ǰƯůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1<A2EUM{STԹVȯxưůůůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ1;@1DTKzRLIƲuŰįįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ1:?0CSJyM=PĸnñįįĮĮĮĮĮĮ29=/BQHwA5Ukx辶븵쳴}}|荒}勉~勉勉勉勉勉勉勉勉勉勉勉勉勉勉勉16;,?NCr,;Wüiμtպyڲvޫuॺt⡹s䝹t囹u暸x暹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{嚹{-37);J+s5BWfoɭnϥmӞm֘lؔlڑnۏpۏsۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏvۏv'- 1&'O2s?JVbbcÕcȏcˊd͇fυhЄkЄnЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄrЄr" !-,R:nEOUVWYZ[}^{`zcyfyjynynynynynynynynynynynynynynyn$13N?dJvONMOPxRtUqXo[n_nbnfnknknknknknknknknknknknknknknk+07ECXHjGyGGzHrKlNhQfUeXd\d_dcdhdhdhdhdhdhdhdhdhdhdhdhdhdhdh ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMYnbkrܩzթѪͧˤɣȣǤǥǦƦħħħħħħħħħħħħħħ ;H.NMXnbkrܩyթЪͨʦȥǥǦǧƨŨĨĨĨĨĨĨĨĨĨĨĨĨĨĨ <H-MMXnajp۪wԪϪ˫ȪƫƬƬƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ <G-MMWnain۫uӫ~ͫɬƬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭ <G-MMWn`il۬sӫ|̫ǬƬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G-LLVn`hkڬqҫ{˫ǬƬƭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =G,LLVn_giڭoҬyˬǬǭƭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,LLVn_fgڮmҭwʬǬǭƭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ =F,KLUn_efۯjҭuʬǭǭǭƭƭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F,KLUn^cd۱gҮsɬǭǭǮƮƮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+KKTn^bb۲dҰoɭȭǮǯƮŮŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭŭ >F+JKTm]``ܵ_ӲjʮzȮǯƯŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm]^]ݹ[ոa˱qǰ|ƯůŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮŮ ?E+JKSm\[YUֿUʶhŰůįĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮĮ ?E*IJRmYWTMVǹlij}įįĮĮî?D)IJQlURMD[ün·zµﺲ񴱀򰱁󯱃򯲅򮲈񮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊𮳊>C)HIPlOM8J_oٿy߿䷸|箶z騵y뤵z좵|좵룶ꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶꣶ=B'GHMjJu98ObȼoѼx׵w۫uߣs᝺s㚺t䘹w䘺{䘺㙺♺♺♺♺♺♺♺♺♺♺♺♺; @&EFG_:p7?RcoȱpΨoҠm֙mؔmڐnۏqێuێzڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}ڏ}9 >$CD;O4s=GUcfeęeȒe̍eΉgЇhцkхoхsхvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅvЅv6 ;!:5.T9rDNXYZ[[\]_}a{dzgzkzozozozozozozozozozozozozo16&53U?nJRPOQRTzVwXuZs]r`qdqhqlqlqlqlqlqlqlqlqlqlqlqlql(+79QEfKuJJJJyMsOoQlTjWiZh]hahehihihihihihihihihihihihihi !15?JD[CjCwD~EuFmHhKeNcQbTaX`[`_`c`f`f`f`f`f`f`f`f`f`f`f`f`f'6.;?;P;_=l}>ws@jBcE^H\LZPYSYVYYX]XaXdXdXdXdXdXdXdXdXdXdXdXdXd.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`b{josyޚ}ڕؑՌԊӉӊӋӌӍΐʒɒɒɒɒɒɒɒɒɒɒɒ.@&LBY`c{josyޜ}ڗדՎԋӊӋӌӍя̑ȓȓȓȓȓȓȓȓȓȓȓȓ. @%MBZ`c{jptyݢ}ٞ֙ӓҏэюяѐ̓ȕÕÕÕÕÕÕÕÕÕÕÕÕ. A%MBZ`d{korwݨ~ؤ՟ҙГϑϑϓ̕ǗØ俗俗俗俗俗俗俗俗俗俗俗俗/ A%NBY`c|impuܩ|ةԤўϘΔ͔͖Ǚě輙缙缙缙缙缙缙缙缙缙缙缙/ B$NAY`c|hknrܪyةөФΝ̘̘ɚŜ뽜뺛깛깛깛깛깛깛깛깛깛깛깛/ B$NAY`b|gilpܫvת}ӪЩ͢˜ʛƞ 췜췜췜췜췜췜췜췜췜췜췜/ B$NAX`b|ehjmܬt׬zӫϪ̨ʡɟĢ񼡒𹟓ﶝ/ C$MAX`b|dfikݮpحwӬ~ϫ̫ɦȢ¥󻢐򷠒𴞓/ C#MAX`a{cegiݰmدtӮzϭ̬ȬƧ󵡑񲞓ﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞﲞ0 C#MAW``{aceg޳hٳoԱvа|̯ɮƭ򯟒𯞒ﯞﯞﯞﯞﯞﯞﯞﯞﯞﯞ0 D#L@W`^z`acd߸e۸iֹpӹvθzƳ𻯆򫟒𫞒﫞﫞﫞﫞﫞﫞﫞﫞﫞﫞0 D#L@V_]y^_`abciξrƸ{´󭬐󪦐󨢑񦟓烈烈烈烈烈烈烈烈烈烈烈0 D#L@V_[w\]]^__jǽt¹}徵쬲񬳈𨳏𥬒𣦒0 E"K@U_YuYZZ\U_l¾vܿ~㵷}馴|젵잭윦윥윥윥윥윥윥윥윥윥윥윥1 E"K?U_WsVVWQSbnҿxڼ~ହy堷x鞷頷螸瘷藮藭藭藭藭藭藭藭藭藭藭藭1 F!K?T_SoR{SMFVdƽpлxײxܤtᚹu䘹|䙺㚺◺⑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺㑺2 F!J>Q\OiNrJAIYgĹq̵vӨr؜pܔrߒwߒ~ޔݕܐݐݐݐݐݐݐݐݐݐݐݐ2 E J>LVK_Hg=CL\hoȨnΞmӔl׎nٌsٌyٍ؎׏ՏՏՏՏՏՏՏՏՏՏՏ 3 DH=HLEO9l?GP^hgœfȓf̌gЇjцn҅s҆yцŀЇňχňχňχňχňχňχňχňχňχňχňχň 4BG;A=3Q;nCLT]^__`ăbd~h}m}r}y~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ~ʀ 6@@,+55U>oHQUUVWXZz\w_vbufukuquxuxuxuxuxuxuxuxuxuxuxux7=,.:9UCkM|PNMNOyQtSqUnXm\l_kckhkokokokokokokokokokokoko3- #1;>RHeIsGGG{HtIoKkMhPfReUdYc\cacgcgcgcgcgcgcgcgcgcgcgcgپ+ )!68BK@\?i@tA}yBqDjEeGaJ_M^P]T\W\[\_\e\e\e\e\e\e\e\e\e\e\e\e -726B7Q9^;jw{f@`B\EZIXLWOVSVVVYU]UcUcUcUcUcUcUcUcUcUcUcUc # &*)-80F2Sv5_l7hc:o]=tX@xUDzSH|RK}QO}PR}PU}OX~O\}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb}Nb} " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYl`glrx~|ywwxyz{|Ԃӂӂӂӂӂӂӂӂӂӂ " 4B9NSYla~glqw|၂|zzz|}~ڀԃ΅ͅͅͅͅͅͅͅͅͅͅ " 5B9OSYla~glpv{ށ}|}ۀڂӅΈȈLjLjLjLjLjLjLjLjLjLj " 5B8OSYla}glpuz݆ہڀځڃӆΉȊË " 5C8OSYka|hmqtz~܋څق؂؄Շ΋ɍÍѾѽѽѽѽѽѽѽѽѽѽ " 6C8OSZkb{inqty~ܑى؅քׇϋʏďԾԺԹԹԹԹԹԹԹԹԹԹ # 6C8PSZjbzhlptx}ܗُևՆӉʏĐ׾׺׶ֵֵֵֵֵֵֵֵֵֵ # 6C8PSZicyfjmqu|ܞٕՊԈ͍Œپڹڵٲرررررررررر # 6C8PS[hawdhkosyݦٝՏӉǑܾܸܴܱۮڭڭڭڭڭڭڭڭڭڭ #7D7PS[f`vcfilpuޫ|ڧ՘ҋ߿߷߲߯ެݪ۩۩۩۩۩۩۩۩۩۩ #7D7QS\e^uadgjmqxܯֿ֤ⴕ⮕⫔ᩔ৓ޥݥܥܥܥܥܥܥܥܥܥ #7D7QS[d]s_adgkouݿyɰծ㤗棖壕㢕⡔ࡓޠݠݠݠݠݠݠݠݠݠ #7D7QSZc[q]_bejqqsƼ{Ԡ␣薚昗嚖㛕ᛔޛޛޛޛޛޛޛޛޛޛ#8E7QRXaYoZ{]`dllpuųyӓz㐨㑟㒚㓗ᕕߕޕޕޕޕޕޕޕޕޕ#8E6RPV_WlXwZ_feipvíxюuތދތߍޏޏޏޏޏޏޏޏޏޏ$8E6RNS\ThVrYx_zZ\dltŤsэsڍڏ؇ډ܉܊܊܊܊܊܊܊܊܊܊܊$9F6QKQXRbTiXkPTXbkpŚnϊp։~֋Պ˜Ճօ׆؆؆؆؆؆؆؆؆؆؆$9G5OGOROYQ\IoMRXbkjĒi͇m҅x҆ĄчŐЅŚЀĦҁӁӁӁӁӁӁӁӁӁӁ$:H5MBLJKLB\GtLRYceeeɂìr̀}́ȇ˂ȑʀȜ{Ǩyǫyǫyǫyǫyǫyǫyǫyǫyǫyǫ%;J4J;G=>FAaGwMS[^_`a}ezm{v{|ˈ}̒|̞z̠z̠z̠z̠z̠z̠z̠z̠z̠z̠%<H,D/C!925:OCfKxSRQRS{UuXq\obnhnonvo~oՈoՋoՋoՋoՋoՋoՋoՋoՋoՋoՋ&A8&49=QFeOuMLLLyNsPmSjWh\gafggmgug}ggggggggggܯ'8  *!6:AOHaFoF{FGwGoHiKfNcRaV`[`__d_k`r`t`t`t`t`t`t`t`t`t`tڲ' /#:9?J>Z>g?q}@ztAmBfDbF^I\MZPYTYXX\XaXhXiXiXiXiXiXiXiXiXiXi׶ %3!435C5P7\z8fq:njqSAsQDtPHuOKvNOvMRwLVwLZwK`wKawKawKawKawKawKawKawKawKawKaw ""/w&;m*Fd-O\1WV4]Q8aN%J*H,F)B;IRNfRxVYXZ|\rcoppqҏrӝpӪkиm·nnnnnnnnn/@F @7)AAGWLjQzUTSVuXm_kikvlՃl֐mלmتgֻfԽfԽfԽfԽfԽfԽfԽfԽfԽ0C=)8/@FG[MlP{OOOxQoUiZfcfnfygڃgێhۛhܩhܭhܭhܭhܭhܭhܭhܭhܭhܭ1= '-93AIH\KlJyJJyKpMiQdVb^afaoaxb߁bbbbbbbbbbb/% 0 ;6BIEZDiDuEzFqGhIbL_R]X\^[f[n[v[\劘\匘\匘\匘\匘\匘\匘\匘\匘\匘%4"=6ny@vpA~hCaE\IYMXRVXV]UdUjUrU|U~U~U~U~U~U~U~U~U~ܫڸ+3!223A5O7Zw8dn:lfwZAzVE}THRMQQPVP[O`OgNoNqNqNqNqNqNqNqNqNqٰ"&',*:~-Et/Ok2Xc4_\7dW:hSR@BS>ES=IT:GGNUUc[pa|govxnhfghmsévĩxêyëy«z«z«z«z«z«z«z«z«z«"2)=9FENSU`[m`zfl}uskghjqx¬yz{||||||||||"2)=7FCNPU^[j`vekr||qlmpu{|}~~"2(<6FAONV[\gasf~kqz|srtx}"2(=4G?OKWW]cbogykqݓz҆{xy|"2(=2H=PHXT__cjgtl~ߥp՚wʐ}~~"1'>1H;QFZP^[bdfmjv٫l΢t™{"1%>/I9SBYL\U`]eeݸduұiǩqw~ēđđÑ"1$>-J6T?WGZO_Ub_׿^s˷fmtzDŽȃDžƇĈ‰"1"?*K3T;UBXG^JY]\qľcjpv{}wv{}ŀÂ#2 ?(L/R6S;V=YDQ[Yo`flqvu~pouwxz|||||||||#2@$N*O/P1T0LAPXVm\bgk|pn{kjoqstvvvvvvvvv#2A L$K&L%M&P?RVTjX|]aerjgxfeĪilnoqqqqqqqqq#3BHEBI-P@USXgXyY[x]hcbu`ԍ_רaehjlllllllll$3C@: =G4MGRZUkTzS}SnVc_`pa܅bݚcޮ`Ħaĩcëfffffffff# 3 ? 1/=%F9KLP^OnM|NvOiRa[^h^y^_ᛠ_᭟^⿞]ɡ_ȣ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ_Ȥ"0.2>*E>KPI`HoH{{InKcO]V[aZnZ|[䋚[嚘[樗[準ZʘZ˘Z˘Z˘Z˘Z˘Z˘Z˘Z˘"# 4?.EACQB`Bm}DxrEgG_LZRW[VeVqV}V鉑VꖏV뤎V붍V췍V췍V췍V췍V췍V췍V췍V췍 ) 7=0hs?riAz`DZHVNSUR]QfQpQ{PPPPPPPPPPPѽ,24/4>4K|6Wr8ah;i`=pY@uUDxQJ{OP|NV|M]|Le|Kn{KwzJzIyIyIyIyIyIyIyIyIyҵ"')+*8z-Dp0Ng2W^5^X8cS\^=c^;K=?L;CM9HM8LM7QM6VM5]M5]M5]M5]M5]M5]M5]M5]M5]Mzo d[ T"M)H/D"3@'7<+9:/;83<67=5;>3??2D?1H?/M?.R?-Y?-Z?-Z?-Z?-Z?-Z?-Z?-Z?-Z?vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{vs lg.&_>9cFEbOR`X_[bjUlrRuyO|N~MMNOOPPR~V~Y}\}_|a{a{a{a{a{a{a{a{ws lg.&`=8dFEdNRaX_]ajWksSuyP}ONNNOPPQȀSWZ~]~_}a}a}a}a}a}a}a}a}xt ni.%e<7jDDjMQgU^b_j\isVs{S|QPPPQQRS˃VσZ҂^Ձ`؁cۀc݁c݁c݁c݁c݁c݁c݁c݁yu ok-%j;6oCBoKOlS]g\iafs[p|VzSRRRSSTŬZφ^҅aՄd؄eۄf݅f݅f݅f݅f݅f݅f݅f݅zv pl-%n94tBAuJNrR[mZhgds_n|YxUTSTTUVÊYˉ]Ήa҈eՇfهgۉhۉhۉhۉhۉhۉhۉhۉhۉ{w rn-%s83yA?zILxPYsXflarek|^uXVUUVWXƍ]ˌaόeӋh֋iٌj؍k؍k؍k؍k؍k؍k؍k؍k؍|x tp-$x71~?=GIOWzVds^plh{dr]}XWWWX[ǐaːeϏiԎk֐lՑmՑnԒnԒnԒnԒnԒnԒnԒnԒ}z uq,$}5/>:GGNTUa{\mseykoby\XXZ\_Ȕe̓jђlӓnҔoҕpҖqіqіqіqіqіqіqіqі~{ vu+#4-?8GDNQU^[j|bvsljvb^^`bdǗjΖnіoИqϙrϚsϚsϚsϚsϚsϚsϚsϚsϚsϚ~| xy*!4*?5HAOMUZ[gas|i~tsk}edegiěmΛqΛs͝t̝u̞v̞v̝v̝v̝v̝v̝v̝v̝v̝}y})4(?3H>OJVV[bangz~quzmijkmpˠtˠvʡwɡxɡxʡyʡyʡyʡyʡyʡyʡyʡyʡ~z(5&@0I;PFVQ\]aiguߊp׀xvpoprtǤxǤyǥzǥzǥ{Ǥ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{ȣ{(5$@.I8PBVM\Xacgnْo}ωu|wtuvxĨ{Ũ|Ĩ|Ũ}Ũ}ŧ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ}Ʀ|(5"@+I4Q>WG]Qa[ۢejҙl{ȑszzy{|~¬~¬«ëĩĨĨĨĨĨĨĨĨ}(5 @(J1R9XB^JaT֧bh̠jy˜qw}~¬êêêêêêêê~(5@%J-R4X;\B۳YRЭ`fƦgwnuz¬¬¬¬¬¬¬¬(5A"K(S/V4X:չUP˲]deulrx}~(5AK#Q(S+O8оSNŸ[bbsioty}usruxz|~~~~~~~~(5ALM PG6PKX`_qekput|lkjnprtvvvvvvvv (5AIHBE3NIV]\ob~gk{pmxgfeiklnoooooooo ' 4@B> 7B0KFRZXl]{bfrjftba`cŧfĩgëi¬j¬j¬j¬j¬j¬j¬j¬j¬& 2 =5-=E-IBNVThXx\w_ie`q]„\Ě\Ʋ]˟`ɢbȤdǥeƦeƦeƦeƦeƦeƦeƦeƦ$.01 @J+O>ORPdSt{UmX`_ZnXӂX՘WرWіZИ\Λ^͝`̞`̞`̞`̞`̞`̞`̞`̞4@H1KCLTLdLrpNcQYZUiT|T摏T觍SŒVҍV֐XԒZӔZӔZӔZӔZӔZӔZӔZӔ  $7A$E6EFEVFduFpgH{[LTTQaPqOONNQӃS؅T܈T܈T܈T܈T܈T܈T܈T܈ ҹ+8<(>8?G?Uw@bkAl_BuWH|QONZMfLtKJ~J|J{IzOyOyOyOyOyOyOyOyԱ) 15)788Fx8Rl9\a;fY?mRDrNKuKSvI]wHhvGuuFtDsDrDqDpDpDpDpDpDpDpDp֪ʺ" )-(/5w0Ak1Ka3TY7\R;bM@fJFhGMjEUjD]jBgjAri?~h>g=g=f=f=f=f=f=f=f=fڣ̴  $#u&/j(9_*BW-JQ1PK5TH;XE@ZBF[@L\>S\<[\;d[9m[8wZ6Z5Y5Y5Y5Y5Y5Y5Y5Yή½ |rg']0U#7N'=I+BD0EA4H>9J<>K:DL8IL6PL4VL3^L2fK0oK/xJ/xJ/xJ/xJ/xJ/xJ/xJ/xJĸwm c YQ$J*E/@$3<(69,871955:3:;1?VI\U܋fbԁmrxtq|mlmnopӔrӔtҕtҕuҔuӔuӓuӓuӓuӓuӓuӓuӓtq l} ,7A%I/P8VBߙ\M֒c_͉kpŁq~yxsqqrst˙vϙwϙwИxИxїxіxіxіxіxіxіxіuq o +7A!H)O2U;ڟZIјb]Ǒimo|v{}wvwwxĝy̝z͝z͜zΛzϚyϙyϙyϙyϙyϙyϙyϙvr r+7@H$O+ߪT3դWG˞`Z—gkmzsy}zz{||ɡ|ʠ|˟|̞{͜{Λ{Λ{Λ{Λ{Λ{Λ{Λvs u  *6?GN$ڮM1ЩUEƣ^Xeilxqw}~ǥȤ~ɢ~ʠ}˟}̞}̞}̞}̞}̞}̞}̞wt x  * 5>F߳LճI/ˮSC[Vcgivoty}{zĩ|Ƨ~ǥȣʡʠʠʠʠʠʠʠxu {  ) 4 =D۹CѸG,ƳQAYT`egtmrv||tqonêqĨtƧvǥxȣyɢyɢyɢyɢyɢyɢyɢyv  '2 : ? 9̽E*O>WQ^bdrinstyjhgf§iƧkƦnǥpȤqȣqȣqȣqȣqȣqȣqȣzw %.426C'L;TN[`aof}jzoludcbadɢfɢgȣiɢjɢjɢjɢjɢjɢjɢjɢ{x !'߾%3@$I8QKW\]laz~fqjer_^^]_Λa͜b̝d̞d̞d̞d̞d̞d̞d̞d̞|z . < F4MGSXXh\vv`ie_n[}ZYYYԒ\Ӕ]і_З`И`И`И`И`И`И`И~~ ڰԾ. 9B/IBNSScyVqlZ~`_YkV{VƎUȣTɼT݇VڊXٌY׎Z֏Z֏Z֏Z֏Z֏Z֏Z֏  ۨҵ5 ?E*G~DMqF[dHgYLqRUvNbxMrwMvLtLsKqLqMtNwOxOxOxOxOxOxOx̵֧ %06":1Lg@W\BaSGiMOnIZoFgoEwnCmCkBjAiEhIhIjIjIjIjIjIjIjڟͯü" +0#30t6=i7H^9QTjd]>]>]>]>]>]>]Щŷ #}(!s,-h.7^0AU3HM7OGJX;SX9]X6iX4xW2V0U0T/S/S/S/S/S/S/S/SӣƲ ypf#&\&/S)7L,=E0B@5E<;H9BI6IJ3QJ2[J/fI-sI+H)G'G'F'F'F'F'F'F'FɮukbYQ%I!+C%0=)48-753939:0?;.F;+N;)V;(`;%j:#u:!9 9 9 9 9 9 9 9|rh^ UM F?9"4%0#'.(),.*)3+'9,$?,"G, N,V+^+h+n+n+n+n+n+n+n+|oe[R IB;5 1.+( &"!$&!!+!0!6 < BIPUUUUUUUY PE#:0!=6%A@0AJ:>UC;`I8mM6zP4Q2R2R2R2R3R3R3R3R4Q9Q=PAPDOGNINININININININZ QF"=.!A3%E=0EH:ARC>^K:jO8wR6T4U4U4U4U4U5U6U6T8TZ?YDYHXLXOWPXQZRZRZRZRZRZRZ] UJ!I(O-"S7-SA8PLCJWMDbUAnZ?{]=^=^>_?^@^A^B^C]D]H\L[P[R\S]U^U^U^U^U^U^U^_ WL N%U+ [6*[@6XJASTLL_VGk]Dw`CbBbCcDbEbFbGaHaI`M`Q_T_VaWbYcYdYdYdYdYdYd` XNT#\*c4(d?3aH?[RKU\UNg^JscHfGfHgIfJfKfMeNeOdRcVcXeZg[h]i]i]i]i]i]i]ia ZPZ d(k3$m=0jF;eOG^YSWc^QneNziMjMkOjPjQiSiThUhXgZi\k^l_m`nananananananc \T`k'r2!u<,tE7oMChVPa`\YjeTvkSnSoTnVnWmYlZl[l\m_o`qbrcrdsdsdsdsdsdsdsd ]Xfq&y1|;'|D3yL>rTKj]Wbgc\rlY}qYrZr[r[r\r]r^s`scudvewfwgwgwgwgwgwgwgwe ^]lv%0:#C.K9|REu[Rne_fnj`xs^w^x_y`yaybycydyfzh{i|j|j|j|j|j|j|j|j|f`bp{$/9B(J3Q>ZKycYpkhitte}{c~d~eefghj‬kဨlဥmဣm•mmmmmmgafu $ .8A#I,P7ۊZD҂aVzifrpslx}iiijklÄlۄnޅoޅpޅp߄p߃p߃p߃p߃p߃p߃p߃hb j x # -7@H&ޖO/ՐWẢ_SĂgcznqtu}o}nnnoppԉrۉrۉr܈r܈r݆r݆r݆r݆r݆r݆r݆hc m | " , 6?FڜM+ЖV?Ǐ^Pealo|r|vysrsstt͎u؎u؍uٌuڋtۊtۉtۉtۉtۉtۉtۉid p  * 4<ޣCՠJ)˛T<•]Nd_jmpz}vy}vvvwwǓwԒwՑw֏w؎vٌvٌvٌvٌvٌvٌvٌje s )1 9 ڨ=ХH'ǠS:[Lb\hknxs~y{yzz{zіzҕzԓyՑy֏y֏y֏y֏y֏y֏y֏kf v&.4֬9̩G$¥Q8YI`Zgilvqv}}~z~x~wv~Κx}Иy|Җz|Ӕ|{Ԓ|{Ց|{Ց|{Ց|{Ց|{Ց|{Ցlg y"(ۯ,Ѱ7ǮE"O5WG^Wefjtnszyromkk͜nϚpИrіt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕt~Ӕmk }ֵ!̵5²BL2UD\Ubdgql~psui~edccϙeϙgИjїlҕlҕlҕlҕlҕlҕlҕnn ڲ йƺ2 @J/RAYQ_adni{xmlsc}`__^Δ`ҔaҕcҕeӔeӔeӔeӔeӔeӔeӔos   ׬Ѷʾ/ =G,O=VN[]`k|ewpiep^{\[[Ž[؍]׏^֏_֐_֐_֐_֐_֐_֐_֐px إаʻ*9C'K9RIWX[ft`shd~^lYyXWVV˃VބX݆Y܈[ۉ[ۉ[ۉ[ۉ[ۉ[ۉ[ۉr~ڞѪʵ $4?#G4MDRSvVakZn`_xXh~UvT~S}R{QyQzS}TVVVVVVVtӤ˯º. :B.H>xLMmP[bTgXZpRetPttOʅsO̘qNͬoMnLnMqOtPvQvQvQvQvQvQvw؝ͪĶ / 8>){C8oFFdJSYN^RVeNbgMqgL܂eLޔdKߨbJaI`GdIgJjKjKjKjKjKjKjݕϤű ,3{8*p;7d>CYANQGVKO[GZ]Fh]Ew\D[DYCXBVBUBWD[D[D[D[D[D[D[ӞǬ&z-p1)e54[8>R;FKAMEIQBRS?]S=jR;zQ:P9O8N8L7K;J61,' #!$*07 ? GOYZZZZZZI@5&2/44"2=%2H-0S4-`8+n;*{=)>(?)?*?+?+?,?-?->.>/>0=2<6<9;;;<<<<<<<<<<<<=>>????????????LA7%8*:/!:8%:C.8O65[<3h@1vB0C/C0D1D2D2D3C4C5C6B6B7A9A=@?@ABBCBCBCBCBCBCMC8%<(?, ?5$@A.>L7:X>8eB6rE5F4G5G5G6G7G8G9F9F:E;EDBCCEEFGGGGGGGGGGGGND;$B%E)G3#H>.FJ7AU?>aE;nH:{J9K:K;K;KJ?I@IAHBHCGFHHJJKKLKLKLKLKLKLP E@!G"L'O1!P<,MG6IR@E]GAjL@vN?O?O@OAOBNCNDNEMFMGLHKHLKNNPOQPRPRPRPRPRPRQ GEMU&X/Y:)VD4RO?LZHHeNFqRE}SESFSGSHSIRJRKQLPMPMPNSQUSVTWUWUWUWUWUWUWS IJT\$a.c8%`B0[L&pG2iP>c[J\eUXp]V{`VaWbXbXbYbZbZb\c\d^f_g`gahbhbhbhbhbhbhW OZh q! w({3|= yE+tN7nYDgbQak]]ud\g\h\i]i^i^i_i`iajblcldlelelelelelelelX P_ m v }' 1;D$~M0yW=q`Njh\dpgazlanaobobococpdpepfqgqhqhqipipipipipipY Tc q {% /8AڇL(сU:z^KseZlmghuof~sfufuguguhuhuiujvkvkukuktktktktktktZ Wg u$, 6ސ?ՍJ%̈T8Á\H{cXtjeoqplyvjyjzkzk{l{l{m{mzmzmymxmwmwmwmwmwmw[ Z ky!)2 ږ<ВH#ǍR5ZFaU|hcvnoruxp~}onoooppp~p}p|o{o{o{o{o{o{\ ] n|%ߚ-՚9˗G “Q2YC`Sfa}lnxrxtyrrrrrsфs߃rrငrq~q~q~q~q~q~] ` q  ۟&П7 ǜEP0XA^Pe_jlowzuv~uuu~v}vˉ|v܇}uޅ}u߃~t~t~t~t~t~t~t^ c u ֣"̣5  CN-V>]Nc\himur{y{yxyvytzrzƌrzڋtyۉux݆vwޅwv߃wv߃wv߃wv߃wv߃wv߃^ f x ܡ Ѧǧ3 AL+T;\KaYfgksp~xuq~m~k~igg؍j}ڋl|ۉnz݇oyޅoyޅoyޅoyޅoyޅoyޅ` j{  ٜԥ̪«1?J(R9YH_Vedip{m|qrhzcba`_ًbڊdۉf܈g~݇g~݇g~݇g~݇g~݇g~݇anڗӠͨŮ.<G%P5WD]Sb`gmukyjpax^]\[Z܆\݇]݇_݆`݆`݆`݆`݆`݆`݆br՛Τǭ*9D!M1SAYO^]ycinhudm~\wZYXXW~WXZZZZZZZdwٕРȩ %5 AI-PjOK`TWWZ`QceOpfMeMdL£bKøaK_HaIdKgLhLhLhLhLhLhyތњƧ. 8v?)kD7aICXNNPUUL_YJmYI|XIҍVHӠUGԶSFRESCWEYF[F[F[F[F[F[֔ɢ~* u2k7$a<1WAL>L>L>L>L>Lݍ͝ª |s$ k+a0"X5,O:5H@;CH@@QA>]B8<8;7:6:6<6<6<6<6<6<Ҙŧx ph _#W(O-%G2,A91=@49H66R64]62j60y5/4.3.2-1,0,0,0,0,0,0,0ȣuld \ TME$?*"9/%56'2=)/F*-O**Z)(f)&u(#'"'"&!% % % % % % %th`XQ IB<61$.**1 '7 $? !HS_m|tg\TLE >71 -(%"#(/6?I T _lxtg[PH@8 2 -'#  $*2<EOY``````;0&+)-)3&; "F""T$"a'"o*!{+ ,!,",",#,$,$,%,&,&+'+(+)*))*)*(+*+*+*+*+*+*<1(),+,0*9!'D#'R&'_)&l,%y-$.%.%/&/'/(/(.).).*.+-,--,-+.+-,0-0-0-0-0-0-=2+'0(0-/6!-B$,O(,\,+i/*v0)1)1*1+1,1,1-1.1.1/0001/1/2.2.20515151515151>30$4%6*63 5?$3L*2X/1e20r3/~4/50505152434344453636272816385;6;6;6;6;6;6@55 :!<&>0=<$;H+9T17a56n75z858697978889898:7;7<6=6=5<7<9?:A;A;A;A;A;A;A7:AE$G.E9#DE+@P3>\8<>I>I>HAHCIEKFMGMGMGMGMGMGD;FOV!Z*Y3V>&RI1MT:I_AHlDGwEHEIEJEKDLDMCNCNCNCOENHMJOLQLRMRMRMRMRMRME@LW_ b(c1a;!\E,VP8Q[ANgGNsIN~JOIOJPJPJQKQKRKRKTLSOSQURVSWSWSWSWSWSWSGER^ f j&k/k9gC&aN2\X>WcGTmMSxPTQTRURURVRVSWSWSXSXVXWZX[X\X\X\X\X\X\XHJW d l q$ s,s6q@mL+gV9`_G[hQYrVY|XYYYZZZZZ[Z[Z\Z][]\]]^^_^`]`]`]`]`]`]IN\ irw"z) {3z=wJ$qT5j\DdeQ`mY^w^^`^`^a_a_a`a`aaaabbccccbcbcbcbcbcbcbK R a nv|&/ ڃ<~H!yR2rZBlbOgiZdrac{ecfcgcgdgdgdgegehfhfgfgffffffffffffL U e rz"߈*Ո9̅FÀP/zX?t_MofYknchvhgkglglhmhmhmhmhmimilikhjhjhjhjhjhjM Y i u~ڍ%Ѝ7 NJDN,W<{^JvdXrkcnrjlzokqkrkrkrkrkrkrkqkpkokmkmkmkmkmkmN \l x Ց"˒5 CM)U9\H}bUxhatokpvrnunvnwnwnwnwnwnunsnrmpmpmpmpmpmpO _o| ّЕǖ3AL'T7[EaS~f_yljursrzxq{q{}q{{q{yq{wq{wqyxqwypuyosyosyosyosyosyosP br؎Ԕ̙š1@J$S4YC_Pd]ii{or}wuzxu~uusuquoumunu|otzqsxrrvrrvrrvrrvrrvrrvS evڊԒϘǝ/>I!Q1X@^McZgf~lqu}rznzzjyhzfzezc{΀dz~fx|hwzjuxjuxjuxjuxjuxjuxV iy֎ϕɜ,;FO.V=\JaWecxjnnoyfva_^]\~\}^~|`|{bzzbyybyybyybyybyyZm}ۈҒʙà(8 DM+T9ZG_S|c`rhkhlu`t|[Z~Y|Y{XyVyXyZy[x\x\x\x\x\x_r֍͖Ş $5 AJ'Q5WB~\Oua[lfgbkp[svWxVwVuUsTrSrTsUtVtVtVtVtVtVtdw݆ёț0=F"M0S>xXJn]Veba\hjVqnT~oSnRlRjQiOiPkQmRnRnRnRnRnRnj}؋̗à+8AI+yN8pSDfXP]]ZVdbQoeP|eOcNbN`M^L^JaLcMeNeNeNeNeNer߃ёƝ #1 <zC$qI2gN>^RHVXQPaWMlYKzXKWJUJTIRHQEUFWGZHZHZHZHZHZz؋˘)y4q<hB*^G5VM?OSGJ]JHiKGwJFȆIFȘHEɫFDEDCAG>J@M@M@M@M@M@MГĠyuo+ g4^: U@+NF4HN:EX8?8?8?8?8?֍Ȝ{qld# \+T1L7$E>+@F/=P1;[2:h1:w09/8.7,7+6*4+1.1/1/1/1/1/̘{phaZ R"K(D.=5"9=%6F&3P'2['0h&/w%.$-#,"+!+!* * * * * * ã{pe]V O HA;%5+22.9+B)L'W%d#t! |odYRKD = 71-)&&,"3;DO\k|     }pcXNG?8 2 -( $ $*1 ; EQ^mz pcWLB:3-( "    &.9D O Y f h h h h h *!$* ,1:FSao{,"#!(#)!/7DQ_lx !"###!!     -##$%'&&+#4"A!N!\!i u ! ! " # # $ % %&'(()(''!&"&"&"&"&"/$")!,"+',2*>)K (X (e"'r#'}#'#($)#*#*#+#,#,"-"."/!/!0 .".$-&-&-&-&-&-&0' .24#5.4:1G"0T#/a%/m'/y'/'0'1'1'2'3'3&4&5&6%6%7$6&5(5*4+6,6,6,6,6,2,59>!?+=6:B"8O&7\)6h+6t,6,7,8,9+:+:+;*<*<)=)>(>)=-2>2>2>2>242;AGI(G3D>!@J'>W-=c/=p0>{0>0?0@0A/B/B.C.D-E-E-D1C4B6B7C8E9E9E9E9E968BJQR&Q0N:IF&FR.D^3Dj5Dv5E5F4G4H3H3H4H4I4I5J5J8I;HJ>K>K>K>K>K>7>H S Z \$[-X7SA"OM,LY4Je8Kq9K{:K;L;L;MZK'VV3R`;Pk@PuBPCQCQCRDRDSDSDSETETFTHSITJUJVJVJVJVJVJ:G T `hkm&k0 i<eH!`S1Z\=WeDVoHVyJVKVKWKWKWLXLXLXLYMXNXOZOZO[O[O[O[O[O=L Z fmqs"s+s9nFiP.cY;_aF\jL[sP[|Q[R[R\S\S\S\S]S]T]U]U^U^T^T^T^T^T^T@P _j qvxz&z7 vDqN*lV9g^EcfN`nT`wW_X`Y`Y`YaYaZaZaZaZaZaYaYaXaXaXaXaXC Scn u z}"5 }BxL'sT6n\CjcNgjVes[d{^d_d_d_d_d`d`d`d`d_d^d]d\d\d\d\d\G Wgqx}ـЄDž2@~K$zS3uZAqaMmgWjn^hvbgdgdgegegegegegegcgbfaf`f`f`f`f`J Zjt{؁ӄˈ‰0?I!Q0|X>x_KseVok^lrej{hjijjjjjjjj}jj|ji|jg{if{id{ic{ic{ic{ic{icM ^mwӄΈƌ.=HP.W;}]HybTth^qnfnvk~mn|mozmoxmovmosmormmsmktlitlhukfukfukfukfukfPapzւψɌ,;FO+V9[EaQzf\vkfzsrmuqzqrpspqsnqskqsjqriqqjqokollnkmnimnimnimnimniSes}҅ˌĐ)9 DM(T6ZB_NdZz}idrynmlvvshuveuvduvbvu`vt_vsauqcsodrmeqleqleqleqleqlVhv؁ΉǏ &7 CK%R3X?]K}bWtfblkld}rs_|}v]|v\|u[}tZ}rY}qY{p[yo]wn^vm^vm^vm^vm^vmZlzԅʍ”"4@I!Q/V<[Gw`Sod^fih^poY{rWrWqVoUmTlSlUlV}lW|lW|lW|lW|lW|l_q~ωƒ0=FN+T7zYCr^NibY`gcYoiUzkTkSiSgRfQdOfPgQgRhRhRhRhRhduփˎ+8 BJ&|P2sU>kZIb_TZf\TnaRzcQbP`P^O\N[L]L_M`MaMaMaMaMaj{ЉƔ $3 >|E tL,lQ8cVC[[LTbTPlWNxXMWLULSKRJPHRFUHVIXIXIXIXIXq؂ˏ,|8t@lF&dK1[P;TVDN^IKhLIuLIJHIGGGFFDDFBIAKBMBMBMBMBMzъŖ|x#r0 k9c@[E(SK2MQ9HZ=Fe?Er>D=C;C:B9A7@9=<:>:@:@:@:@:@كʒ~rkg$a/ Z7R>KD'FL-BU0@a0?n/>}.>э-=џ+<ҵ*;):*7-504242424242ύ›uj_[U#N+H4B;=D :N"9Y"8f"8t!7 65541/ -"-"-"-"-"Ɨvk`WRLE# ?)91592B0L.X-e,t+*)((&%%%%%wk`UNH B< 61&--)5&>#G!S`p       xk_UKC=72 - ($ !'.6@KX h z         yl_TI@82,(#     % , 6 A N ] m}|m_SH>4-'!     ! * 5 AN[gqqqqq((*/ 7ES`ny                 '%',5BP ^ k w   $"#)2?M[ht! "#!$"0 <IWdp{  !!"##$%&&&%$$$####""()+!,,*8(E'R'_'l'w(()**+,,-../.--------$(/277(542@0M/[/g0s0}1233455677766 6"5#5$5$5$5$5$%.6<AB%?0<<8H7U 7b 8n!9y!9 : ; <<=>>>??!>%='=)<*<+<+<+<+<+(5= E K L#J,E7AC?P">]$?i%@t%A~$B$B%B%C%C&D&D&D'E'E)E,D.C0C1C1D1D1D1D1.; C NTU T) P2K>HK"FW'Fc*Gn,Gx-H-H.I.I.I/J/J/J0J0K1J3J5J6I7J7J7J7J7J73@ KV \^]%Z. V;SHOS)M]0Mh3Mr5M{5N6N6N7O7O7O7O8P8P8P:OS>T>T?T?T?T?U@UAUBUBUBUBUBUBUBUB< IWag ijk$j5 fBbM&]U3Z^;Xg@WpCWyDXEXEXEXFYFYFYFYGYGYHXHYGYGYGYGYGYG@ M\ekmn q!q3n@jJ#eS1a[;_cC]kH\tJ\|K\L\L]L]L]M\M\M\M\M\M\L\K\K\K\K\KC Q`inrsvw0u>qH mQ.iX:e`DcgJaoN`wQ`R`R`R`S`S`S_S_S_S_R_Q_O_O_O_O_OFUclrvx{|.{<wGtO+pV8l]ChdKekQdsUc{WcXcXcXcXcYbYbYbW~bV~bU~bS}bS}bS}bS}bSIYfovz|,:}EyN(vU5r[AnaKjgShnXfv[f]f]f^}f^{f^ye^we^we\weZweYwdWwdWwdWwdWwdWL\isz~Ā)8 DL%|S3xY>s_IpdRlkZ}jr_zi{axibvicticricpicnhcni`ni^oh\pgZpgZpgZpgZpgZO_lv}Ƃ'6 BK#R0}WGN)T5Y@x^KqcVi|h_ayof]wxjZwjYxiXxhWxgVyeUxdVvcWtbYraYr`Yr`Yr`Yr`YjẃÉ.; EL%R1{W=s\Gk`Rcf[[lcWvfUfTeScSaR`P`P~`Q{`Sx_Sx_Sx_Sx_Sx_^o|Ɇ*8 BJ!}P-uU8mZCe^M]dVWk\Su_Q_Q]P[OZOXMXKZLZM[M[M[M[M[ctρċ$3>~FwM(oR3gX=_\GXbORjTOuVNUNTMRLPLNJOHQGRITITITITITizʇ-}9 wBoH"hN-`S7XY@R_GNhKKtKJJJIIGIFHDGDEGCICJCKCKCKCKqҁō~{&u3n<gC`I%XN/RT7L\=Ie?Gq?F~?F=E>=@=@=@=@=@zˈtok*e5 ^<WCPI&JO-FW1Ca3Bm2A{1@0@/?->,>+;.917464646464҃đxlb ^Z*T3 N;HBCI!?R$=]$89A6K5V4b4p3ڀ2ۑ1ۥ1ܽ/-+)))))~qeZPFB=8#3+ /4->+H)T(a'p& % $ # " !      sg[PG=84/+ '' #0 9 C N \ l ~tg[PF<3/*& "! ( 1 ; GTdwvh[PE:1*%   '1=JYk}xj\PD9/&   %1>LZhxyyyy" & % ',5DQ^ k w "$#$)3AO\ i u  !!  % 1 > LYe q |             "-:HUan x               #$*!6CQ]iu~  ! ! " # # $ % % % % %%%$$$$$#'*..&,2)>'L'Y'e'p)z**+,,-.// / 0/./..----!)/ 6 : 9"7-390F0T0`1l3v34566677889887766666&0 7 @DD A( =49@8N9[:g;r<{<==>>????@@?!?#>$>%=%=%=%=%,6 @I MNK$F. C;AIAUBaBkCu C}!D!D!E"E"E"E#F#F#F$F&F(E*E*E+E+E+E+E+1 <GQUVTP(O7 LDIP I[%Ie'Io(Ix)J)J*J*K+K+K+K+L,L,L-K/K0K1K1K1K1K1K16 ANVZ[ YY$Y4 VARL!PV)O_-Oi0Or1Oz1O2P2P2P3P3Q3Q4Q4Q5Q6P7P7P6P6P6P6P6: ES[^_] a b1_>[IXR*U[1Td5Tl7Tu8T}9T9U:U:U:U:U;U;U;TKW^dfehi.g<cG_O)\W2Z`9YhXx?X@X@X@XAXAXAXAXBXBXAWAW@W?W?W?W?AO[cikkmo,m:jDgM&cU1a\:^c?]kC\sE\{F\F\F\G\G[G[G[H[G[F[EZDZDZDZDZDES^gmpprt)s8 qCmK$jS/fY9c`AagF`oI_wK_L_L_L_M^M~^M|^M{^Lz^Ky^Jy]Hy]Gy]Gy]Gy]GHVbkquuvy'x6 vAsJ!pQ-lW8i]AfdHdjLbrOb{Q}bR{bRybRwaRuaRsaRraQraOqaMr`Lr`Kr`Kr`Kr`KKYeouyy{ }$}4{?xHuO*rU5n[?kaH}hgNyfnSvewUteWreWpeWneWldWjdWidVidSidQjcOjcNjcNjcNjcNM\iry|~ !1=}F{N'wT3tY=}q^FwmdNrkjUnirYki|[ih\gi[eh[ch[ahZ`hYahWahTcfRcfQcfQcfQcfQO_mv|/; EL$}R0zW:yw\DrtaMkqgUfnn[bmw^_m_^m^\m^Zm]Ym\XmZXmXYlV[jU\jT\jT\jT\jTSdqz,9 BJ!P,{U7t}ZAlz_JewdS_ukZZst^Xs_Vs^Ut\Tt[StYRtXRsXRqVToUUnTUnTUnTUnTXhu~(6@H|N(vS3oX=g]F_bOY}iVU{rZR{~ZQ{YQ|WP|VO|TN|SMzSLySNvSNuSNuSNuSNuS\myƒ#2=~EwL$pQ.iV8a[AZ`JTgPPqSO}SNRMPMNLLKKIMHNHNI}NI}NI}NI}Nbs.~9 xBqIjO)cT3\YG>>?>?>?>?qˀ|v rn-h7 b?[FUL$OR,JY1Fb4Dm4Cy3C2B0A/@-@,>.<1:394949494yŇzkfc#^/Y8 R?MFGM!CT%@^'>i'>v&=%<$<";!: 8"6%4'3(3(3(3(̂sfYUR$N/I7 C??F;O9Y8d7r655431/.----Čwj^RGB@ <*844= 1F 0Q /] .j -y ,ъ +ќ *ҳ )( & $####zmaUJ@5/ -*#'-%8$C"O!\ k{|obWLA7-(% " )2=IV f y  qdWLA6-%   ! *5AO`tseXL@6,#   *7FXkugYL@4*!  ,<L^o~&#"$* 4 B P]iu%! !&2 ? M Zgr| "  #/ < I Wcoy  + 8 E S _ku~          (4A N [ gr{       # & %# "/< I V b mw !"##$$%%&&'' ' ' &%%%%$ ' / 1 0 -* *7 'D 'Q (^ )i +s ,| --. . / / 0 0 1 1 2 1000////# + 2: <;7$30 0> 0L 2Y 4d 5n6w7788999::::99988888) 1;CE D@<);8 ;Fh>q?y?@@@@AAAAAA@@@ @ @ @ @ . 7BIKJ GF$F4 EADMDXDbEkEtF{FFGG G G G!G!H!G$G%F%F&E&E&E&E&3=HNPOK PQ0O=LHKS K\#Kf%Kn%Kv&K~'L'L'L(M(M(M)M)M)L+L+K,K+J+J+J+J+8BMSXYUXZ-X:UERO"QX'P`+Pi,Pq-Qy.Q.Q/Q/Q/Q0Q0P0P1P1P1O1O1O0O0O0O0<GQZ_`]_a*`8 ]CZL!XT)V\/Ud2Ul3Tt4T|5T5T6T6T6T7T7T7S7S7S6S6R5R5R5R5?KV_dfdeg'f5 d@aI^Q)[Y1Z`6Xg8Xo:Xw;X;WgGdO'aV1^\7]c<[k>[r@[{AZAZB}ZB{ZByZBwZCvYBuYAtY?tY>tY=tY=tY=tY=CR_hmpoo q!q1p<mEjM%gS/dZ7a`>_gB}^nDz^vFx^Gw^Gu^Gs]Gq]Ho]Hm\Gl]El]Cl\Bm\@m\@m\@m\@FUclqtssuv.u: rDoK"lQ-iW6~f]>ydcDubjHrarJpa{LnaLlaLjaLh`Lf`Ld`Ld`Id`Ge`Ee_De_De_De_DJZgouxxwz{,y8 wBuI rP*~oU4ylZ=si`DngfJjenNgewPedPcdPadP_dP]dO[dO\dL\dJ]cH^bG^bG^bG^bGM^ksx{||~)~6 |@zHwN'zuS1trX:mo]CgmcJbjjO_isR\i~SZiSYiRWiRViQTiPThNUhLVgJWfIWfIWfIWfIQbnw|&4>F|}L$u{Q.oxV7hv[@as`H\qgNWopRUo{SSoRRoQQpPPpNOpMNoLNnKNmJPkIPkIPkIPkIVgs{ !0; }CwJ pO*jT3c}Y<\{^DVxeKRwnNPwyOOwNNwLMxJLxIKxGJvGIuHItHJrGJrGJrGJrG\lw,}8 wAqGkM%dR.]W7W\?RcENmGLxHKFJEJCIAH@G@E}BD|BDzCDzCDzCDzCbr||'w4q=kDeJ ^P)XU1R[8Mb=Jl?Hw?H=G&>$=#: 9C6K4U3`2l1z10 / - - +)((((sfYMA7 53$0..8+A*L(W'd'r&Ȃ$Ȕ#Ȩ" vi\PE9/& %0<HUduۇܜܵ     yk^RG;1(  ) 5BP`s|n`TH<1' !,:I[npbUH<1'  "0@Sh}rdVI<0%  %6I^q$ ! & 2@N[gq{!    " /=KXdox   , :HUalu}      ) 6CQ]hrz     % 1?LYdnw     !,:GT_js{  ')&#'3AO[ f!p#x$$%&''(())**) ) ) ( ( ( (  $,23 0, (,&;)I+V-`.j/s0z11223 3 3 3 3 4 3 3222222%*4::7 20$254C 6P 7[ 8e 9m 9u:|::;;;<<<<;;;:::::*1<?@=8 =>0>> >J?U@_@hApAwA~BBBBBBBBBBAA@@@@/8AGJICGI,H9 GEFPFYFbGjGrGyGHHHHHHGG G!F!F!E!E!E!E!4>FOSSNPR(Q6 OAMKLTL]!Le"Lm#Lt$L|$L$L%L%L%L&L&L&K'K'K'J'J&J&J&J&6BMVZ[VWY%Y3 W>THRP!QX%Q`(Ph)Po*Pw+P+P,P,P,P-P-O-O-O-N-~N,~N+~N+~N+~N+9FS\`a^] _"_1^<[EXM!VU(U\,Tc/Tk0Sr1Sz1S2S2S2S3}S3{S3yR4xR3wR2vR1vQ0vQ/vQ/vQ/<KXaefdb ee.d: aC^K \R(ZY.X_2Wg5Wn6~Wv7|V8{V8yV8wV8uV9sV9qU9pU8oU6oU5oU4oU3oU3oU3@P]eikigij,i8 gAdIaO'_V/~]\4{[c8xZj;vZrlY>jY>hX>gXn]n@l]wAj]Bh]Bf]Bd\Bb\B`\B_\@_\>_[<`[;`[:`[:`[:FYelqsqprs&s3q=oE~lL"yjQ+tgW4oe\;jcb@fbjCcarEa`}F_`F]`F[`FY`EX`EW_CX_AX_?Y_=Y_=Y_=Y_=K]hpuvuuvx#x1v; tCzrJupO)omU1ikZ9ch_@_gfE[eoHYeyIWeIVeHTeGSeFQeEPdDQdBQc@Rc?Rc>Rc>Rc>Paltyzyy{ | }.{9 {zAvxHpvM%jtR.dqW7^o]>XmcDTklGRkvHPkHOkGNkEMkDLkBKkAKjAKi@Kh?Kh?Kh?Kh?Vfqx}~~~+|6w?q~Fk|K!ezP*_xU3Yv[:Sta@OsjCMstDLsCKsBJs@Is>Hs=Gs.=0;1;1;1;1ivuojg(c3^; XBSHNN IU%E])Bf*Ar*@~)@'?&>$="=!:$8&7(7(7(7(q}~pe_\Y,U5P= KDGKBR?[=d >E:M8V6`5l4y43210 .-,+++sgZNC><":,653>1G /P -[ ,f ,t+*('&$# " ! ! ! ymaTH;0*)'(%2#<"F Q]k{reXL@3) ' 3 @ M [k}БЦuh[NB6+"+9GWi}xj]PD7,!  "0ARf{|m^QD7,! &9LavoaSE8,   /DYm!   #0>LXdnx    .;IUaku}   *8EQ]hrz   &4ANYdnv}   "/<IU`jsz   )7DP\fov}   #0>KWajsz !!!! !!!$('#'7 F"R%]&f(n(v)}***++,,,,,,,, + + + + #-/-( &!*1-@/M0W2a2i3q4x4~4555 5 6 6 6 6 5 544333%+39;8036,7;8G 9R :[ ;d ;l >A(A6AB ALAVB^BfBnBuC|CCCCCCBBBAA@@@@+7DLONHGJ$J2I=HHHQGYGaGiGpGwG~GHHGGGGFFEEEEE/=KSVVPO R R/Q: ODMMLUL\Ld Kk!Kr"Kz"K"L#K#K#K$K$}J${J$zJ$yI#xI"xI"xI"xI"4DQY\\WUXY,W8 UASIQQ PX#P_%Of'On(Ov(O~)~O)|O)zO)xO*vN*tN*sN*rM)qM(pM'pM&pM&pM&8JV^aa][]^)]5 [?YGVN!UU&T[)}Sb,{Sj-yRq.xRz.vR/tR/rR/pR0nR0lQ0jQ/iQ.iQ,iP+iP*iP*iP*;O[bfeb`bc'b3a=^E\K }ZR&yXX,vW^/tVf1rVm3pVv4nU4lU4jU5hU5eU5cT5bT4bT2bT0bT/bS.bS.bS.AS_fjhfdfh$g1f; dC}aIx_O&t]U,p[[1lZb5jYi7gYr8eY{9cY9aY9_X9]X9[X9ZW8ZW6ZW4ZW2[W1[W1[W1FXcjmljijl!l.k8 ~iAygGteM$obS+j`X2f_^7b^f:_]n<]\x=[\=Y\=W\Uat?Sa?Ra>Qa=OaMg~>Lg=Kg;Jg:Ig8Hg7Gf7Ge6Gd5Gc5Gc5Gc5Veovwwwwy}zy|%u{1pz: kyAewG`uM"ZtR*UrW1Pp^6Lof9Jop:Io|9Ho8Go6Fo4Eo3Do1Cm2Bl2Ak2Aj2Aj2Aj2\jsz{{{|}~ws o-j7e>`~EZ}JU{P$PzU+Kx\0Hxe3Fwo3Ew{2Dx0Cx/Bx-Ax+@x*?v+=t,$=#=!;~#9}$8{&7z&7z&7z&iu|oga^![-W6R> NDIJDQAY>b =m KV`iqx~   +9FQ\emt{ %2@LWaiqw}   +9GR\ e m t{  "3AMXaip w }!"""###$$$$$$####((# !-%<'I)S*\+d,l,s-y-.../////...-,,,$.563+*.(072C3N4W5_5g6n6u6{777 7 7 7 7 7 6 6 5 5 4 4 4 +8?A?859#:2:>;I w\EsZKnXQ$kWW)hV^,eUe.cUm0aUw0_U1]U1[T1YT0WT0US0US.US,UR*VR(VR(VR(GWagfecbcef)|e4xd<sbCn`Ii^O#e\T)a[[.^Za1[Yj3YXs4WX~4UX4SX4RX3PX3NW2NW0NV.OV,OV+OV+OV+L[ejiihfhj}k&xj1si: ngAieGddM!_bR([`X.W_^2T^f5R]p6P]{6N]5M]4K]3J]2I]1H\0H[.HZ-IZ,IZ,IZ,Q_immllkm{oxp"sp.oo8 jm?elE`jKZhP%VfV,Qe\1Ndd4Kcn5Jcy5Ic3Hc2Fc1Ec/Dc-Cb-Ba-B`,B_+B_+B_+Wdmppppp{rut runu+iu5es= `rCZqIUoN!QmT(LlZ-Ikb0Gkl0Ekx0Dk.Ck-Bk+Ak)@k(?j(>h(=g(=f(=f(=f(\irtttt|uuwoyk{g{'c{1_z: Zy@UxFPvLKuR"GtX&Dsa)Bsk)Asv(@s'?s%>s$=s"|j!=|u <|;|:|9|8|7z5x4w3v3v3vit|||}~ti_Y VS&P0L8H? DF@M:8 6*431</D-M+W*b)n({'%$#! |qeYMC8-'&$'#1!; DOZftwk_SH<1& " , 7 B MZiy}qeYNB6* (3?KZj}xl`SF9-!  #/;IYlρϖέrdVH;/# &4DVlvgXK=/# ,=Rizj[M>1$ %7Lby+9GS^hpw} (6DP[dmtz   $2?LW`ipw}  -;GR\emsy'5BNXaiov{  /<HS\dlrx} (6CNX`hnuz  / = IS\ckqw} $$)7D N!X"_#g$m%t%z&&&'''''''&&%%%,22-% %$(2*?,J-S.[.b/i/p0v0}00000000///...*6<=82- 13-4:5E5N6V6]7d7k7r7x7 8 8 8 8 7 7 7 6 ~6 }5 }5 |4 |4 3?FEA<7:<)<5<@ {LFxKMuJSsJZqJaoJhnJplJyjJhIfIdI bH `H ^H^G^G]F]F]F=MWZYWTRS UV)~U3zS<vRCrPJoOPlNVjN]!hMd"fMl#dMu$bM$`M$^M$\L$ZL$XK$WK#WK!WJWJWJWJBQ[]\[YVXZ[&zZ1vY: qWAmUGiTMfSS!cRY$`Q`&^Qi(\Qr(ZP|(XP)VP(TP(SO(QO(PO&PN$PN"PM!PM PM GV_`__][]~^z`#v_/q^7 m]?h[EdYK`XP"\VV&YU])WUe+TTn,STy,QT,OT+MT+LT*JS)IS(IR&IR$JQ#JQ"JQ"LZcccba_~aycud qd,md5hb=daC__I[]N!V\T&SZZ*PZb,NYl-LYv-JY-IY,GY+FY)EY(CX'CW&CV%CV$DV#DV#Q^fffeedyfth pilj)hi3dh: _gAZeGVcLQbR#M`X(J``+H_i,F_t+E_*D_)B`'A_&@_$?_#>]#=\#=[#=["=["Wcjjiiizisknmiofo%co/^n8 Zm>UlDQjJLiPHhV$Eg^&Cgh'Ags&@g%?g$>g"=g of =orxS;x[9xe8xq7x}6x5x4w3w3v1t0s/q.q.qisuuuvywmyb}YQMK H*E3A;>B :I 7P5Y4c3o2|1 0 / . - +} *| )z)z)zpyzyz~zt|i]TJB>=":,754=2D0M.V -`,l+y*('&$#""! ! w~~~zodXND91 .,#+,)5'>%G$Q"[!g tui^SG=2(  *3=GR_l {  {ocXMA5+! &0;FSapvi]RF;/$#-8DRbt}pdXL@4( )5AQcwnjƣƽxk_SE7* $0>Pczߑߨ޿sdUG9,+;Nc{wgXJ;- "5Jax )7DPZdlsy   %4@LW`ipv|  !/<HS\elsy~*7CNXahouz %2>JT]dkqv|+9EOX`gmsx}%2?IS[biouz  +8DNW ^ e k q w ~ !  $2?IRZahntz )/,' -":$E%N&V&]'d'j(q(w)~))))))))((''')4962-%(+),5.@.I/R0Y0_0f1l1s1z112211}1{0y0x/w/w.w.!2>@>;7124$515;6E6M7T7[7b7h7o8v ~8~ }8 {8 z8 x7 v7 t7 r6 p6 o5 o5 n4 n4 ):EFEB>::< =-<7<@ _>_=_=8GPONMIGGIJ&}I1yH: uGArFHpFOnEVlE\jEchEkgEteE}cEaE_D]D[CYCXCXBXBXAXA=LSSRQNKMN}P$xO.tN7 pL?lKEiJLgJRdIYbI`aIg_Ip]Iz[IYHWHUHSGRFQFQFQEQEQEBQVVUTRPR|SxT!tT,pS5kR<gPCdOI`NO^MU[M\YMd WLm!ULw!TL!RL!PL!NK!LK KJ JJKIKIKHKHGUYYYXVT|VwXsYoY)kY3gW: bVA^TF[SLWRRTQY"RQa#PPj$NPt$LP$KP#IP#GP"FO!DO!DNDNDMELELLY\\\[Z}Yw[r] n^j_&f^0b]8 ^\?ZZDVYJRWPNVV"KV^$IUg%GUq%FU}$EU#CU"BU!@U ?U>T>S>R>Q>QR]____^x^q`lbhced#ad-]c6Yb< U`BP_HL]NI\T F\\"C[e#B[p#A[|"?\!>\=\<[:[9Z8X8W8W8WWbccbb}crckefgah^i[i*Xi3Th: Og@KeFGdLDcSAcZ?cd=cnkQ4*$"!%.7@JU`m{ }}||y}nbWLA7-#  # , 6 @KWesth\QF:0& !*4?LYhy{nbVK?3(  (3>K[l~uh\PD8-" $/;J\o}pcWK?2& *8I\r؉ס׷yl_RD5(  &4G\tteVG7)!1E\s &4ALW`hpv{ #0=IS]elsx},9DOYbiouz~ &4@KU]dkqv{!.;FOX`flrw| )5@JS[bhnsx~"/;ENV]djouz  '4?IQY`flrw~  . : DMU\bhnu{ ')%!(5?IQX^dk q x!!!!!!!~!|!{!z z z (220,' "$$0&;'E(M(T)Z)a*g*n*u+|+~+}+{+y*w*u*s)r)q(q(q("199851,),.,/7/@0H0P1V1]}1c|1j{2qy2yw2v2t2r2p1n1l1j0i/h/h.h.*:??><852 46(636<|6D{7Ly7Rw7Yv7_t7f s7m q7v o7~ m7 l7 j7 h7 f6 d6 b5 a5 a4 `4 `3 1ADDDA>;:;=$|=/x<8v<@ sS>R=R<R<R<>KLLLJGF~FzGvIrI)nH2jG: gFAdEGaEN_ET]D[[DcZDkXDuVDTDRDPCNCLBLALAL@L?L?COOOONLJyKuL qNmN'iN0eM8 aK>^JE[JKXIQVHXTH_RHhPHrOH}MHKGIGGGEFEFEEEDEDECHRRRRRPzNtPpQlShS$eS.aR6]Q< YPBUOHRNNPMUML\KLeILoHLzFLDLCLAK?K?J>I?I?H?HMUUUUU}TvRoUjVfXcX!`X+\X3XW: TU@PTFMSLJRRGQZEQbCQmAQx@Q?Q=Q KZDGYJDXPAXX?Xa=Wk1$  /AWnymaSD4%  ,@Vn #1=IT^flrx} -9FPZbiotz~ (6ALU]ekqv{#1<GPY`gmrw|+7BKT[bhmsx} %1<FNV]cinty+6@IQX_ejou{ $0;DLTZ`flqx~ *5?HOV\b h n u | ~}|| ""   $/:CKRY_ekry}{zxvutss(++)&"+6? G!O!U"["b~#h}#o{#wz#x$w$u#s#q#o#m#l"k"k!j!"1232.+'" $&'(2);~)D|*K{*Ry*Xx+^v+eu+ls+sr,|p,n,l+j+h+f*e*c)b)b(b(*799852/+-/#|0.y07w0?u1Gs1Nq1Tp1Zn2am2hk2pj2yh2f2d2b1`1^0\0[/[/Z.Z.2<=>=;863}4z6v6*r63p6<n6Cl7Jj7Ph7Wg7] e7e c7m b7v `7 ^7 \7 Z6 X6 V5 U5 T4 S3 S2 S2 9@ABA@=;|9x: t<p='m<0i<8g<@ eDEFEDA|@w?r@ oBkC$hB.dB5aA< ^@C \@IZ@PX@WV?^T?fS?pQ?zO?M?K?I>G=F=F<F;F:F:CGHIIH}FxDrDmFiGfH!cH+_G3\F: XE@ VEFSDMQDSOD[MCcKCmJCxHCFCDCBB@B?A?@?@??@>HKLLLLzJsGmIhKdLaM^M(ZM1WL7 SK> PJDMIJKHPHHXFH`DHjCHuAH?H>HMh=Ms;M:M8M7M5M4L3K3I3I3HPQRRRzRrRiQbT]UYW UXSX"PX+MW3IW9 FV? BUE?TLj:k8k6k'4k/1k6/k>-jE+jN*kW(ka'km%jz$j"j!i hhfdcb```auakbbcWfOiHk?n6p0r -s+s *s)(s1&s9$sA#sJ!sT s^sjsxrrqpomlkjddd{eqehf^hSlKnBq9t0v'y { {{!{*{2|;{D{N{Y{e{s { z yxwvt s siiiwinjdkYnOqEu|5+"!)2=IUcsts{sqtevYyN}C7-# )3>KYi{zyxyk{_SH<0&(3?N_qsfYMA5)$0>Oawzm`TG:."  !-=Pe{ˑȪuh[OB5)*<Ri~qdXL?1!&;Rk -;FQZbipuz*7BLV^flrw| &2=HQZahmsx} -9CLU\cinsx~'3=FOW]cinsy~ "-8AIQX^diotz'2<DLSY_djou|!,6?GNU[`flrx   &0:BJPW\bhov}~|zywvvv  +5 > F M SY_fl}t||zywusqpnmmm#%%#  &0:B~I|P{Vy\xbviuqsyrpnlkigeedd#*,-+)&"!} ,z!6x">v#Ft#Ls#Sq$Yp$_o$fm%nk%vj%h%f%d%b$`$^$]#\#\"\"+0221/-*&}%y'v))s)2q*:o*Bm+Ik+Oj+Uh,\g,ce,kd,tb,}`,^,\+Z+X+V*U*U)T(T(2577753}0z.v- s/o0%l0.j17h1>f1Ed1Lb1Ra1Y_1`^2h\2qZ2{X2V1T1R1P0O/N/M.M-M,79;;;:}7x6t4q4m5j6"f7+c63a6;_6B]6H[6OY6U X6\ V6d T6n S6x Q6 O6 M6 K5 I5 G4 G3 G2 G1 G1 ;=???>z<t:p9k:h;d<a<(^<1[<8X;>V;E T;K R;R Q;Y O:a M:k K;u I: H: F: C9 B9 @8 @7 @7 @6 @5 ?@BBB}Bv@p>k>f?b@_B\B&YB.VA5S@; P@B N?H L?OJ?VH?^F?hD?rB?~@?>>=>;>9= 9< 9; 9: :: BDEEFyErDlBfCaE]F ZGWG#TG+QG2NF9 KE? HDEEDLCDSAD\?De=DpEGHIIvInHgF`H[JWKTLQM OM)LL0HL6EK= BJC ?JJ=IQ;IY9Ic7In6I{4I3I 2I 0I /H .G -E -D -CIJKL|LsLkLbL[NVOQQNRKRIR&FR-CR4@Q:n5q-t$vy|~ $-6~@~K~W~d~s}}|zyxwvggvglhbhWkMoCr8v/y&{~  $,6BN\k|m}lslim]oRsGw<{1~'  #,7DRasrzrprduWxL|@4)  ",8GWi|xxxkz^~RE8-"  ,9J]q~reXL?2&(7J_wŽzm`SF9,  &7Lczߧݻui\OB5(#7Nf~+7BNW_fmsx} '3>IRZbhoty~"/:CMU]cioty)4>GPW^dioty $.9BJRX^diotz)3<ELSY^diou{ $-7?GNTY_djpv}(1:BIOU[`flrz~}|{zz  ",5=DKQW\bho~w|{ywvtsqppp  '09@G}M|S{Yy_xfwmuut~rpnmkih g f f    !~ +{4y<xCvJtPsVq]pcnkmsk|igfdb`_^^] #&&%#!}yv't0q9p@nGlMkSiZh`fhepcza_]\ZXWVUU&)+,+*({%x"v r o!#m"-j#5h$=g$Ce%Jd%Pb%W`&^_&e]&n\&xZ&X&V%T%R%P$O$N#N"N"+.010/z.u+r)o'l'i) f*)c*2a+9`+@^+G\,M[,TY,[X,bV,kT,uR,P,N,L+J+H*G)G(G(G'/2455|4v2q0m/i.f.c0`0&]1.[16Y1=W1CU1JT1PR1WP1_O1hM1rK1~I1G1E0C0A/@.@-@,@,36899x8r7m4h3d4`4 ]6Z6#X6+U63S69P6@N6FM6MK6TI6\ G6e F6p D6{ B6 @5 =5 ;4:4939291907:;<}<u<n;h9d8_9[: X;U< R<)O<0M;6J;=H;C F:J D:R B:Z @:c >:m <:y :: 8: 7: 59 39 38 37 36 35 ;=>?z@q@j?d>^=Z>U?R@PAMB&JA-GA4E@:B@A @?G =?O ;?W 9?` 8?k 6?w 4? 3? 1? 0> .>-= -; -: -: >@ABwCnCgC`BYBTDPELFJGHG#EG+BG1?F8 9EE 7EM 5EU 3E_ 2Ei 0Ev /E .E,E+D)D(B'A'@ '? ACEFtFkFcF\GSGNIJJFL CLAM ?M(V8X3Y 1Y/Y -Y(+Z/)Y7'Y>%YG#YO"ZY ZdYqYYXWVUTRRMNOtPiQ`QXRPSHVAX9[2]*_&`$a#a"!a+ a2a:aCaLaVaaan`|`_ ^ ] \ Z Y XQR|SpTeU]UUVLXC[<^4`,c$eh hhh$i,i5i=iG hQ h]higwgffdca`_VWwXkXbYZYQ[H]>a6d.f&iln q qqq&p.p7pApKpWpcoronnmkihg[\r\g]_]V^LaCd8g0j'mpr uxxxyy'y/y9yDyPy]ykx{wwvtsrq`zanada[bQeGhL[l|lrkhk\nPrDv9z-~"  %1?O`tyqpqctVxJ|=1% %2CUiwwjz]~QD6* $3G\rreXK>0$  1G]wאצֺmaTG8+2Iby (4?IS[ciouz $/:DNV]djpuz*5?HQX^djouz %0:CKRY_djot{!*4=ELSY^diou{%.8@GMSY^diov}  )2:BHNTY_djqx$-5=DJOUZ`fmt}~|{yxwvvvu (18?FK~Q|W{\zbxiwqvytsqonmlkjj   "~,|4z;xBwHuMtSrYq_pfnnmwkihfdcaa``}zw't/r7q>o Dn Jl Pk Wi ]h ef md vc a _ ] [ Y X W W W  }ywv sp"m+k3i:gAfGdNcTa[`b^k\tZYWUSQPOOO#$%&|%w#s pnlif'd0b7`>^D]K[QZXX`W hU rS }Q OMKIHHGG$()*+x+r)m&j$h!e!b"_#$]$,[%4Y%;X%AV%HT&NS&UQ&]P&fN&oL&zJ&H&F%D%B$A$@#@"@"(,-/|/t/m.i,e*b(_( \)Y*!W+)U+1S+7Q+>O+DN,KL,RJ,ZH,cG,mE,xC,A+>+<*:*9)9(9'9',013y3p2j2d0`.].Y.V/S0Q0&O1-L14J1;I1AG1HE1OC1WA1`?1j=1v;191705/3/2.2-2,3,0356v6m6f6`5\2W3S4P5N6K6#I6+F61D68B6>@6E>6M<6U:6^86h66t462515/4-4,3,2,1-0468}9r:j:b9\9W6R8N9K: H;F< C<(A;/>;5<;<:;C8;J5;S4;\2;f0;r.;-;+:):(9&8&7&6&579;z<o=f=_=Y=R<M>I?E@BA@A=A%;A,8A36A93A@1AH0AP.AZ,Ae+Aq)A~'A&@$@"?!> < ; :;=?w?l@c@\AUAMAGCCE?F;G9G7G"4G)2G00G7.G>,GF*GO(GX'Gc%Go#G}"G FFEDBA@>@BsCiC`DXDQEIFBH=J8L4M 1M/N-N&+N-)N4'N<%ND#NM"NV NaNnN{MMLKJIGFBD|EpFeG\GUHNIEK?M8O2Q,S(T&T$T"#T)!U1U9UAUJUTU_TkTyTSR Q P O NMFHxIlJaKYKQKKLBO:R4T-V%Y[ [[[$\,\4\=\F\P [[ [g [uZZYXVUTSKLsMgN^NVOOOGQ>T6W/Y'\^ac c c c&c.c7c@cKbVbbbpaa`_^\[ZO|QoRcRZRSSKTBW9Z0](_ begjkkk k(k1k:jEjPj\jjizihgfecbTvVjV`VXVOWFZ<]3`*d!filoqr rss!t)t2t=tIsVsdstrqqpnmlZq[f[][U[J^@a6e,h"lortwyzz {|}"~*4~A~N~\~m}|{{yxwy_m`c`Z`ObDf9j/n$rux{} "*7ETdwteieaeUhIk=p2t'x|  +:J[mpkhj[mOqBv6{* *;M`vopbsUwI|;.! -@Tkjy]~PC4( ,C\tыҢѶeXK=0" -D]w$0;ENW^dkpv{ +6@IQY_ekpv{&1;DLSY_ejpu{ !+5>FMSY_djou|&/8@HNTY^diov~ !*3;BINTY^djpx%.6=DJOTY_eks{~}||{{{  )18?EJPU~Z}`|gznywxvusrqpppp$,~3|:zAyFwLvQtWs]rcpkosm}ljigffeed ~ |yw'u/s6q<pBnHmNkSjYh`ghfqd{ca_^\\[ZZ |x wusp"m*k2i9h?fEeKcQbW`^_f]o\yZXVTSRQQQztqon li f &d .b 5a ;_ B^H\N[UY\WeVnTyRPNLJIIHH!|!t njhfe b_"]*[1Y8X?VEUKSRQZPbNlLwJHFDBAAAA!#%x&p%i$e"b_^ [XV'T.R5Q<OBN IL PK WI `G jE uC A ? =;9999"%'~)t*l*e)`']%Z#W"U"R#P$$N%+L%2J%9I&?G&FF&MD&UB&^@&g>&s<&9&7&5%3$2$2#2"2!&)+{,q-h.a-\,X*U(Q(O) L*J*!H+(F+/D+5B+<@+C?,J=,R;,[9,e7,p4,}2+1+/*-*+)+(,',&),.x0n0e1^1X0T/P-L.I/ F/D0B0%@1,=13;1991@81H61P41Y21c01o.1{,1*0(0'/%.%-%,&+-/2u3k4b4[4T4O3K2G4C4@5>6<6"96)76056636>16E/6N.6W,6a*6m(6z&6$6#5!5 431003~5r6g7_7W7Q7K7E8A9=::; 7<5< 3<'1<-/<4-<;+<;7:x<k=a=X>Q>J?D@;B6D1E-G)H'H%H #I'!I/ I6I>IGIQI\IhIuHGG F E D B A;>t?h@]AUAMBGB@D8F3H-J&L!N OOO#O+O2O;ODONOY Oe OrNNMLKJIH@}BpCdDZEQEJEDF=H4K.M(O!QTV VV V& V. V6V?VIVTU`UmU|TSRQPOODyFkG`HVHNHHIAJ8M0P)R"TWZ ]]]]!])]1]:]D]O][\i\x[[ZYXVUIsKfL\LSLLLDMeIeUecdrccba`_^|NnPbPXPQPIQ?S6V-Z$]`c ehjk llmn$o-o7nBnOn]nmm~lkkjigvTiU^UVTNUDW9[0^&beh knpstu vwxy%z.z:yGyVyexwwvuusspYdZ\YSYI\=_2c(hko ruwz|}%/=M]ok_b^Y^NaBe6i+nrv z} $2CTf{hd`dTgHk;p.u"z~  $5I[ogjZmNqAv4|&  %8LazbsUwH}:- )>Un͆͝ͳ]~PB4& (@\w ,7AJRY`fkqv|'2<EMTZ`fkqv} ",6?GNTZ`ekpw}'1:BIOUZ_ejpw #+4<CJOUZ_djqy&/7>DJOTZ_eks{!*19?EKPUZ`fn}v|{zyxwvvvv %,4:~@}F{KzPxVw[ubtirqp{pomlkjjjj |z y(w/v5t<rAqGoLnQmWk^iegmfwedba`____|zvtro#n*l1j7i=gCfHdNcTaZ`b^j]t[ZXWUUUUT x t pol jhf&d-b3`9_?^E\K[QYXX_VhUrS~QOMLLKJJ yrlif fda_!])[/Y6X<VBUHSORVP ^N gM qK }I G EDBAAA~tlfb_^] [ X V%T,S3Q9O?NFLMKTI\GfEqC}A?=;9999z p!g!a \YWVTQO!M)L/J6H<GCEJDRBZ@d>o;{97531122"w$l%d%]$X#T!RPM KIG&E,C3B 9@ @? H=!O;!X9!b7!m4!y2!0 . ,**++"%s'i(`(Y(T'P&M#J"G#E#C$A%#?%*=%0;&69&=8&E6&M4&V2&`0&k.&x,&*&'%%$$$$#$"%!"&|(p*e+],V+P+L*H(E(A)?)<*:+ 8+'6+-4+42+;1+B/,K-,T+,^),i',v%,#+!+*))('&)y+m-b.Z/R/M.H.C-?.;/8/ 604021$01+.11,18*1@)1I'1R%1\#1h!1u110//.-,)-v/j0_1V2O2I2D2?2945425/6-6,7!*7((7/&76$7>"7F!7P7Z7f7s76654321-0s2g3\4S5L5F5@6:739/:,;(< &<$=#=%!=,=3=;=D=N=X=d=q=< ; ; : 9 8 71}4o5c7Y7P8I8C9=96;0=+>&@!B BCC!C)C0D8DACKCV Ca Cn C}BA@?>=<5y8l9`:U;M;F<@<:=3?-A'C!EGI JJJ% J, J4 J=JGIRI]IjIyHGFEDCC:u<g=\>R>J?C?=?7A/C(F"HJM OPPQ!P(P0P9PBPMPYPfOuONMLKJI>p@cAXBOBGBAB:C2F+H#KMPRUW WXX#X+W3W=WHWTWaWpVVUSRQQzCkE^FTFLFEE>F5I-L%OQTVY\] ^^_`%`.`7`B_O_\_k^|^]\ZZYtHfJZJQJJIBJ9M0P'SVY[^acde fgh i'i1i<iIiWhfhwgfedcbmNaNWNONGN=Q3T*W [^ bdgjlmop qrt u(u3u@tOt^sprqpoonhS]STSMRBU6Y,]!ae iloqtvwyz| } *7FWh}~|{{{cYZXSXGZ;_/c$hl ptwz} *:L_s`^Y]M`@e3j'otx} -ATi`cSfFk9p,v|1G[qZlMq@w2}$!6Md~ʗȰUwG}:+&?Yr(3=FMT[aflrx~ #-8AIPV\aflrx(2<DKQV\aflry$-6>EKQV[afls{ (08@FLQV[agmu}"+3:@FKPV[agow~}}}| %-4:AFKP~V}\{bzjxrv|trsrqpppp~ }(|/z6x;wAuFtKrQqWp]ndlmjwhgfeedccd~zw usr#p*o0m6l<jAiGhLfReXc`ai`r^}\\ZYXXXYytqnljhf%e,d2b7`=_B]H\N[UY\WeVnTySRPONNNN x pkhfd b`^!\([.Y4X9V?UETKRQQYObMlLwJIGFEEEE {qid` ^][ YWU$S*R0P6O<NBLHKOIWG`EjDvB@>=<<;; vld^ZWU T SQN M'K-J 3H 9G ?E FC NB V@ _> j< v9 7 5 4 311 1~rh_YTQONM KHF#E*C0A6@=>D<L:T8^6i4u2/-+)))*{nd [ UPLIHFDB@ >'<-:48:7B5J3R1\/g-t+(&$"""#w k"`#X#Q#L"H!D C@= ;97$5*3 12 80 ?/!H-!P+!Z)!e&!r$!"  t#h%]&T&N&H&D%@$=#9#7$4$2%1%!/%(-&.+&5*&=(&E&&N$&X"&d &p&&%$$#""#q&e(Z)Q)K)E)@);)7(4)1*.*,+*+)+%',,%,3#,;!,C ,L,W,b,o,}++*)(('#|&n)b+W,N,G,B,<-7-2-./+/(0 %1#1"1" 2)20282A2J2U2`2m2| 1 0 //. - ,'y)k,^.T/K/D0>09040.2)4$5!67777&8-858>8H8R 8^ 7j7x7654322*u-h/[1Q2H2A3;36314*6%7 9;= =>>#>* >2 >:>D=N=Z=f=u=<;:987/q1d3X4M5E6>69636.7':!<>@C DDDD&D.D6D@DJCVCcCqCBA@?>=|3m5_7T8J9B9<9690:*<">ACE HJ JKK"K*K2K;JFJRJ_JmJ~IHFEDDw8h:[;P<G<@<:<3=,?%ADFI KNO PQRS%S-R6RARMQ[QiQzQQOMLKq=c?V@L@D@>?7@/B'EHKM ORUVW XZ[ [([1[<ZHZVZeYvYYWUTSkB^CRDIDCC;C2F*I!LOR UWZ\^_` bcd"e+d5dAdOc_cpbba_^]eHYHOHHG@G6J-M#QTXZ]`ceghjk mnp#p.p:oHoXnjm}lkjih_MUMMLFL;O0S&VZ^behknprtuwy z|~$~0~>}O|a|u{xwvu[SSRLQ@T4X)]afjnqtwz|~ &4EXmYWRVFZ9^,cinsw{~%8LaxX]L`?e1j$pv{ *@VmRfFk8q*x~ -E\tˎɧMq?x1~# 7Oi $/9CKRX^chnsz  *4>FMSY^cinu{&/8@HNTY_dipv~  *3;BHNSX]cipx$-4;BHMSX]cjr{ '/6<AGLQW]ckt~}{ywxxxvu!)06;~@|E{KyQwVv]tdrmqwomljkjjjj}{ yxw#u*s0q6p;o@mElKkQiXg_fhdrb~`_^^^]]]{vrpmkji%h+f1e7c<bAaF_M^S\Z[cYmWyVTTSRRQQxqlifc a`_!^'\-[2Y7X=WBUHTORVQ_OiMuLJJIHHGHyphc_][Y WVU#S)R.Q4O9N>MEKLJSH\FfDqB~BA@?>>> s i a [ WUTR POML%J+I0H6F;EBCIBP@Y>c;o:|9865555 {nd\VQN L LJ IGE!C'B-@3?9=@<G:O8X6b4n2{1/-,,,, vj_WQLHFED C A ? = $; *: 18 76 >5 F3 N1 X. c, o* }( % $ # ! sf\SMGC@?>< :86!4(3.15/<.D,M*W'a%n#| }obXPID?;97531/.%,+*2(:'B%K#U!`lzzl_ U!M!F!@!;!7 42/- +)' "% ($ 0"!7 !@!I!S!^!k!y      wi!\#R$I$B$<$7$3#0#,#)$&$$%"% &&&&-&5&=&G&Q&\&i&w & %$##"!t!f$Y%O&F'?'9'4'0',''(#) *+ +,,#,*,2-;,D,O ,Z ,f,s,+*)('' q%b'V(L)C*<*6*1*-*)*"-./0 122 2' 2/ 372@2K2V1b1p10/.--,}$m(_*S,I,@-9-4-/-+-&.0246 8 888$8+838=8G7R7_7m7}754322x(i+[.O/E0=07010-/(0"2468 ;= >>>!>(>0?9>C>O=\=j=z=<:988t-e/W2L3B3:34302*3$579< >@B CDEF$F+F4F>EKDXDfDwDCB@?>o2`4S5H6?68635-6&8:=? BDGHJ KLNN'N0N:MFLSLcKsKKKHFEi7[9N:D:=:7909(; >AC FIKNOQ RTVW"W+W5V@UNU^ToTSSQPMc<U=J>B>;=4=,?#BEH KNQSVWY[ ]_`a%a/`:`H_X^j^}]\\YX]BQBGB@A9A/C&GJN QTWZ\_abdf hjlm(l4kAjQjdiwhgffcWGMGFF?E4H)LPT X[^aegjlmoqsu wzz+y8xHw[voutrqpSLLKEJ9M-R"V[ _dgknqtvxz|~  .>Pe{RQKP>S2X%^b hlquy| "2E[rQVEY7^*djpv{"7Ne~K`>e0k"ry~)BZrNJ¥Ek7r)y .G`y !,6@HOV\bgmsy(1;CKQW\aglsz ",5=DKQV\agmt}&/7>DJOUZ`fmt~  (07=CHLRX^emv}{z"*17=BFKPV^}f{ozzxvtrqqqon ~}$}+{1y7x<vAuFsKrPpWn_miksigedccdcczvsqpon%m,k1i7h<gAfFdLcRbY`d^n\yZXWVWWXWzsnjge dbb a'_,^2]7[<ZAYGXMVTU^SiQtOMLKLLMLypic`][YXWW"U(T-S3R8Q=OCNIMPKZIdGpE}CABBBBB}rh`ZWTRQ ONNM$K)J/I4G9F?EECMAV?`=l;y9799888wkaYSOLKIH GFE C%A+@0?6=<<B:J8S6]4i2v110////r f \ T M I E CBA @>=;":'8-73594@2H0Q.[-g+u*('&%&&| naWOIC@= ; :: 8643$1*00.7->+G)P'[%f#t! yj^SKD?:7543 2 0 . - "+ () /(6&>$G"Q\hv     ugZPHA;630.-+*(&$%",!4<EOZft     rcWMD=73/,)'%# !"*1:CMXe r o`TJA:40,(%!    !'!/!7!A !K !U!a!n!} {k]Q G!>"7"1"-!)!%!!!"$$&&& '$ '+ '4'=&G&R&^&l&{&$#"! xhZ!N#D$;%4%/$*$&$"$$&(* + ,,,!,(,0-9,C,N+[+i+x++('&%td#V%K&A'8(1','(&$& &(*, .1 1222%2-353?2K1X1f1v00.-++p#`&R(G*=*5*/**)&)")*,/ 135 6789"9)929;9G8T7c7s766421k'\*N,C-:.3--,)+$,-/2 469;< >?@@%@.A8AC?Q>`=p===;98f+W/J0@17110,/&/135 8:=?AC DFHI!I*I3I>HLG[EmEEDDA?`1R3F4=45402*2"479 <?BDGIJL NPRS%S.S9RFQVOhN{NMMLIZ6M8B8:846.6%8;> ADGJMORTVX Z]_^(^3]@[PZbYwXWWVUT<I<?<9;2:(=@D GKNQTVY[]_bd gik"j-i:hIf[epdcbaaOAEA>@8?-B"EJ NQUX[^adfhkmor uwx%w2uAtTsiqpommKFDE>D2G&KPUZ]adgknqsuwy|~(7I^v~|{JJDI7M+RW\afjorvy|+>RjJO=S0X#_djpvz1F^wDY6_)el sz 8RjÃÜ=e/l!s{*G_w*4=EMTZ`ekqx $.8@GMSY^djpx)19@FKPUZahpx"*29@EJOTY_foz~}$,39?DINSY_gp~}{xtsr %,39>C~H}M{SzYx`wiutspnlkjggf|zxwww&u-s3r8q=pBoHmMlTj[icgme{b`^\\[\[}wqnkj iii!h(g.e3c8b=aB_H^N\U[^ZgXsVTQOOOQQ{rjea_^]]\\"Z(X-W2V8T=SCRIPPOYMbLnJHFDCFGG~rg`ZWUSR RQPO#N(L-K3I8H>GEELDTB^Ai?z=:98<<=vj_WRNLJIH GFFD$B)A.?4>:<A;H9P8Z6f4u2101233~pcYQKGDB@? >=<; 9%8*6/563=2D0M/W-d+q*)())))yj^TKE@<:876 5431!/&.,-2+:*A(J'T%a#o"~! tfY O G @ : 6 3 100. -+*($')&0$7#?!H S_m|p b VKC<62., * ) ) '%$"!!' .6>H R^l{   } m ^RH?82.*'%#"! &.6?IT ` l {    z i[OE<5/*&#!$+4 = F P\ixwfXLB92,'#   ! (/8BMYfvscUI>6/)%!    !$!,!5!>!I V d to_QF;3,'" "$%%&&"&)&2';'F&T%b%r$$$!k[NB!8"0"*!$!!  " $&(* +,,,&,/-8-C-O+_*p*))(&$gW!J#?%5%-$'$## ""#% ')+-/ 1333#4+454@4L2\1m00//,*b"S%F';(2(+'&&"%$&' *,/2468 :;;;';1<<==;W,J.>/4/--)+#+-/258;=@BEGI KNNN(N3N?NMK`IuGGFEEQ1E2:322-0'/147:>ACFIKNPRU WZZ"Z-Y:YHXYUoRRQPPL6@78624+3!69=@DGJMPSVXZ]`b fhh&h2gAeQbh`^]\[G;=;7908%;?CGKOSVY\_bdgilor vwv+u:sJp`nxlkihC@=?6=+@EJOSX\_beilnqsvy| "1BWo|{ywCDUoiDhJfQdXbaak_w^][YVSRRunigfedddc#a(_-]3\8Z=YCWIVRT[ReQqPOMKIGGGsia][YWW VVVT"R(P,N1L7J<ICHJGTF`DkCzB@?=<<?vi_WSOMLKJ IHFD"C'A,@2>8=>;E:N8Z7f7t6432226}naWPJFCA@>< <<:8#7(6-433:2A0J/V.b,p+*)))+-vh[QIB=:7543 3310.$-),0+6)>(F'R%^$l#~!!!!"$qbVLC<73/-,,+ +*(' &&$,#3";!CO[iz|l^QG>71-)'&%$# #! #)08AMYgwxhZM C : 3 - ( % "   &.6@KWd t ueV J ?6/)%!         $ , 5 ? J V c s qa S G<3,&"    #*3=HTaq n ] PD90)#    '/:EQ_o j ZM@6-&!  $-6BN\mfWI=3+$     "!*!3!? L ZlbSF:0("  "% &&''''1';'I'W&h#}#"!!^OB6-%  !#&(+ --..$...8.F.T-d*z(('''YK>"3"*"#!  "%'),/14 666!6*656B6P6`2w0/...T!F$9&/%($"#!!" $&),.1369; >???'?1?>?L?\=p96655O&A(5)-)&'"%$&(+-1369<?ADG JJK!J,J9JGIWHjC@@?>I+<-2-++&) (*,037:=@CFIKNQT WWV&V3VAUQTdOLJIHC18200*.$-/2 6:>ADHKNQSVY\_b ee d,d;cKa]]xYVVU?65503)148 <AEIMPSWZ]_begknrtt&s4sCqUmoifed;:58/7#:? DHMRVZ^aehknqtwz~*;N}fzwut;>5<)@E KRV[`dhkosvy| 1D\v;B/F!LRY_ejoswz~$8Oi5M(SY agntz(@Zv.Y ahpw0Lg  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D7LHT]\sbhlo߽rٹuӵzͰƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭƭ( 2<&D6KHS]Zs`ehjlmʽrݽx誱( 2<&D6KGR]Ys^bcehkѺoڭs䛴zzzzzzzzzzzzzzzzz( 2<%D5JGQ\Ws\^`cfŹiήlסpu鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u鐷u( 2<%C4JFP[VrY\_bd¯gˤjӗm܈q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q䈺q( 2;%C3IEOZTrV[^aceǛhϏjׂnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނnނn( 2;$C2ICNYQqTZ]_acÓeˇg}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l}l( 2;#C0IAMWOpSX\^`abƁexjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxjxj(2;!C.H?JVMoRWZ\^_`{bshshshshshshshshshshshshshshshshsh(2;B+H;IVLnPUY[\\~^u`nenenenenenenenenenenenenenenenene(2;B&DVAb~EluIsmLxhN|cP`S]VZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZYZY$/1&346A:N{=Yr@ajDhdGl`Jo]MqZOsXRtVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVuVVu % )*#,/1;{5Fq9Ph=Xa@^\DbYGeWJgUMiSQjRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTkRTk% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /:$C3JBTU]if|ov~圄܍؈ֆ{شrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴrٴr% /9$B2JAST\hd|ltz䣀ޜږՎҊ޷zvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫvޫv% /9$B1JART[hc|jqv|ݥ؟Җ͏}{{{{{{{{{{{{{{{% /9$B1I@QSZha}hnrwۮ{֩ѣ馇ꛂ囂囂囂囂囂囂囂囂囂囂囂囂囂囂% /9#A0I?PSXh_}ejnqںuչ}ȯಟꞒ쒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉蒉% /9#A/H?PRWh^}cgilrx־ߨ阢틓ꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓꋓ% /9#A.H>OQVg\}`ceinͼrְxޞ~蔵뇢臢臢臢臢臢臢臢臢臢臢臢臢臢臢% /9"A.H=NQUgZ}^_bfºi̯mբqޑv牸煳关关关关关关关关关关关关关关% /9!A-G2@EBWEfIsN~|QtSlTgVbY^]\bZgZgZgZgZgZgZgZgZgZgZgZgZgZgZg#(* 6:1;A>QB_Ej|ItsM{kOfRaT^W[[Y_XcXcXcXcXcXcXcXcXcXcXcXcXcXcXc,24.7<:J=VzAaqDiiHocKs_Nv\QxZTyXW{V[{U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_|U_| ),.*175Cx9MnVTAYQD[PG\NK]MN^LQ_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_LT_" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@/I=TM^_hqqz뇉灐|zzztljjjjjjjjjjjjj" ,6"@.I*F8MIV]]qdkpu۰|ל״ݮߜߓڒגגגגגגגגגגגג" ,6 >)F7MHU\\qbhlrԷyǭκ֬ޢ┋ዃ܋ڋڋڋڋڋڋڋڋڋڋڋڋ" ,6>(F6LGT\[qaejpͽv|ͳդݖ㍓ㄉ߄܄܄܄܄܄܄܄܄܄܄܄܄" ,6>(E6LGS[Yp^bgmsùx̬}՝݌㇟~~~~~~~~~~~~~~" ,5>'E5KFRZXp\`ejp²u̥yԕ}܇ᅮ{zzzzzzzzzzzzz" ,5=&E3KDQYVoY]bgkp˝tӍxڃށyxxxxxxxxxxxxx",5=$D2JCOWTnV[_cfiʐl҃p|}yvuuuuuuuuuuuuu"+5=#D0JANUPlTZ]_abȂcwhsuq‡oÜqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤqĤ"+5= D-I=KSNkRX[]__{aqemqkƀjǒiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗiǗ"+4<C)G9JSMjP~VY[\~]t_ldhmgzf̉e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎e̎!+4<B"D:HRKhNzSWYZv[m]gbdjbua҂a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆a҆!+ 3;="C;FQHdKuQTVxWoYh[c`_f^p]{\\\\\\\\\\\\\!* 2 1<%A;BNE_HnM{QzSpUiWcZ_^\c[kYtYwYwYwYwYwYwYwYwYwYwYwYwYw ')2:&=9?JAYEgIrzM{qPiRcU_X\\Z`XgWnWqWqWqWqWqWqWqWqWqWqWqWqWq#15&86:D=RA^yDhpHphLvbOz^R}[U~YYW]VbThTjTjTjTjTjTjTjTjTjTjTjTjTj  & -/$225>8JwWWA[TE]QI_PL`OOaNRaMVaLZbK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\bK\b !$(t)2i-;`1BY5GT8KPQPXd_xekظr̰x~³̨ԟ؜؏؉Ԉψψψψψψψψψψψ (2;"B.I=POWd]xciӾpƵv{­ˡӕِڈځցссссссссссс(2:!B-Is6Hj:Pb=W[A\WE`TIbRMdPQeOUeNYfM]fLcfLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeLfeظ  "%$}).r,8h1@_4GY8LTVM`^jnt~}󁆙zvttsplffhêhêhêhêhêhêhêhêhêhêhê %09%B/J=UL_]hnr~{򉃜퀋zvvupifilllllllllll %/9$B.J;TK]\gnpxꇈ~xuvrmjmooooooooooo %/8#A-I:RJ[\ennv~㌄ۀyxzxºr¯mprrrrrrrrrrr %/8"A,H9PIZ[bmkt{ܑ҇~|}ſ}ųwĨqĤsuuuuuuuuuuu %/8!@+H8OHXZamiqw֙~̎…»ǸǷǬ|ǡvǝwxxxxxxxxxxx %/8 @*G7OGWY_mgnۧuО|ƕ²ȮʭʥʚzɖyÔzzzzzzzzzzz %/8@)G6NFVX]ldk֭sˤyɥ̣̝̒~̎|Ǝ}}}}}}}}}}} %/7?'G5METW\kbܹiѱqũw|ɛΘϕϊ·ɇÇÇÇÇÇÇÇÇÇÇ %/7?&F4LCSVZj`~ؿg˶ntz~ɒύыт~%.7?%F2LBRTXi^}eƼlqv{ȉЂӀ{vxxxxxxxxxxx%.7>#E0K@PRVg\|cinsw{ǁzyvqqqqqqqqqqqq%.6>!E.J=NOSfYz`fjosvz|utrmmmmmmmmmmmm%.6=D*I9LLQdWy]bfjm~qsxponjjjjjjjjjjjj%-5=C&H4KJObTwY]adfukmukDŽjʖjͫffffffffffff%-5<BE3JJMaQtUXZ\v^jceod}cьbѝaҲaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻaʻ$ , 4 :<D4HJJ_MqRUWzXmZd``j_v^փ]ג\ؤ[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش[ش$+12 < B5EIG\JlNzR~UrVhYa_]g[qZ|YވXޘXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥXߥ"''2;"?5BGDWGfKsO~uRkTcX]]ZdYmXvW倘V捗V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖V晖  28#;4>C@RC_FkvKtmO|eR_VZ[XaVhUpTyTSSSSSSSSSSS  %/3#619?BA=EA*G6QD[TeenuwztponmiefëiǤkˠkˠkˠkˠkˠkˠkˠkˠkˠkˠ ",5 >)G5PCZScdluu}uppqsnjjlŨnȣnȣnȣnȣnȣnȣnȣnȣnȣnȣ ",5>'F3OAXRbcktsz݄yttuwtomp¬qƧqƧqƧqƧqƧqƧqƧqƧqƧqƧ ",5>&E2M@VP_bitqߔw֋~́zxyzytqstêtêtêtêtêtêtêtêtêtê "+4=$E0L>UO]bftnٛuВ|ƈ||~xtvwwwwwwwwww "+4=#D/K=SN\`dsݨkԡsʙz}xyyyyyyyyyyy "+4<"D-KC"G:LRRgWy\`cfrjisffeãdŸbbbbbbbbbbb ! ( 0 6 ;@#G:JOOdSvWZ\u_idcoaaҐ`Ԣ_ַ]]ê]ê]ê]ê]ê]ê]ê]ê]ê]ê !'-16@%E;HNKaOrRUxVkYa_]j[yZ܇YݖYݦW޻XɢXɢXɢXɢXɢXɢXɢXɢXɢXɢ #%$7>'B:ELG]KlOy|RpTfX^^ZgYsXW䌛V䚚U嫙T庘T庘T庘T庘T庘T庘T庘T庘T庘T庘 )6;(>9AIDXGe~KqsN{iRaV[\XdVnUyU샌T쏋T퟊SSSSSSSSSS + 37(:7=D@Q}B]sFgjJobOv\TzXZ}Ua~Si~Rq~R{}Q|Q{PzPzPzPzPzPzPzPzPzPz ֿ) .2&538?{;Jq>ThA]`EcZJhVPkSVmQ\nPcoOjnNqnNzmMlMlMlMlMlMlMlMlMlMlMlֶ$(+#//z29o5Bf8J^MICOGHPFMPDQQCVQB[QBaPAiPAoOAoOAoOAoOAoOAoOAoOAoOAoOAoOθ  wl %a$-Y'3R,8M0HD=KD97A96D95H94L93P93P93P93P93P93P93P93P93P93P9} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt} yr"i."p5't?0tI:tTFobShp^d|fbkbmbnbocpcpdqdqcrbr`s^s\tZtZtZtZtZtZtZtZtZt~ zs!l-!s5&w>/yH9xSEs`Rmm^hzhendqdsdtdueuevfwdwbx`x^y[zZyZyZyZyZyZyZyZyZy { u!p,x4$}>-G7QDz^Qtj_nvjisgxf{f|g}g~ggeԀcׁ`ڂ]݃\]~]~]~]~]~]~]~]~]~ | v!t*}4#=+F6PB\P{g^urko~vj}ihhhhhˈfщcԊ_֌\ٌ^݇_߃_߃_߃_߃_߃_߃_߃_߃_߃ } w x*3!<)E4N@ZOe^{pltzxnkjiiiiǑf͒bє^ҕ_Ցbڋb܈b܈b܈b܈b܈b܈b܈b܈b܈ ~ x {*3<'D2M?XMc]ml{wztnkjiih›fʜa̞`ΛcҖe֐fٌfٌfٌfٌfٌfٌfٌfٌfٌ  y ~)2;%D0L=WLa\kltzz}rljiijjɢfɢdʠfΚhӔiՐiՐiՐiՐiՐiՐiՐiՐiՐ  z )2;$C.K;VJ`Zikr{zvnklmnpƥkǥhǤj˟lЙlҕlҕlҕlҕlҕlҕlҕlҕlҕ  { )1:"C,K9UH^Ygjp{އv}}uppqrspĩlĩmȣo͝pЙpЙpЙpЙpЙpЙpЙpЙpЙ  | (1: B*J7SF]Xfim{؎tυ{|vtuvwu¬p¬qŧrʠs͜s͜s͜s͜s͜s͜s͜s͜s͜  }(1:B(I5QEZVch۝kzҕrɌx~|yyz{zutëuȤvʠvʠvʠvʠvʠvʠvʠvʠvʠ  }(09A&H3OCXTag֢iy͚qÒw|~|}~ywxŧxȣxȣxȣxȣxȣxȣxȣxȣxȣ  '09@$G1N@WRܮ_fҧgwȠnuz}z{ë{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ{Ʀ  '08@"G/M>VOس]dͫevålsx|}}}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ}ĩ  '07? F,L;޼TNӷ\cȰctjpuz~z||¬|¬|¬|¬|¬|¬|¬|¬|¬  '/7>E)K7QLϼZaõashnsw{|yxvqsttttttttt  &.6=D%I4OJX__qekptx}}sppojlmmmmmmmmm   & . 5<B E2MHU]\obglptuymkjjfgggggggggg   & - 4;@A/KFS[Ym_|dhkyonuhffecc¬cĩcĩcĩcĩcĩcĩcĩcĩcĩ  %+2 7 8@,ICPXVj[z_b}fpigqc~baa_ê_ŧ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ_Ǥ #(-.:C)G@MURgVwY\s_gd`m^|]Ɍ]˞\ͯ[ȣZʠZ̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞Z̞  ",;B+E>IQMcPsRuUhX_^[jYyX܊XݛW߬VšUИVҕVҕVҕVҕVҕVҕVҕVҕVҕ / 9?,B=ENH^LlyOxmRcV\]XhVvUꄐU꓏T뢎S볍ŘQыQыQыQыQыQыQыQыQы پ/ 6;,>;AJCXzGdpKnfOw^T}X[UdTpS|RRQP~O}O}O}O}O}O}O}O}O}  ڴ",26*98n:He=Q\@XVE]RL`OScMZdKbdKjdJscI}bIaH`H`H`H`H`H`H`H`H`H`ѵ!&*$w./l18c4@[7FT;LN?OKERHKTFRUEXUD_UCgTCoTBxSBRAQAQAQAQAQAQAQAQAQӮȾu"!k&)a*1Y-8R1=L5AH9CE>ECCFAHG?NG>SG=YG<_G;fF:pE9vE9vE9vE9vE9vE9vE9vE9vE9vEɸ ti_$V!+O%0I)4E.7A29>6:<;;:?<9C<7H<6L<5Q<4W;3];2b:2b:2b:2b:2b:2b:2b:2b:2b:}rg ]T L%G)B",>&.:*/8-16115523821<20@2/C2-H2,M1+P1+P1+P1+P1+P1+P1+P1+P1+P1r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`r md#]."c4'f>/eH8aSB^bLZpTX}YX[Y\Y]Z][][]\^\^]^]^\_[_Z_X`X`X`X`X`X`X`X`X`s me"`,!g3&j=-iG7fRBb`L^nV[{[Z_[`[a\a\b]b]b^c^c^c]d[dZeXeXdXdXdXdXdXdXdXdt of"e+l2$p<+pE5nO@j]LdkW`w_^d]f]h^h^i_j_j`j`k_l^l\mZmYkZjZjZjZjZjZjZjZju pg"i)q1"u;)vD3uN?q[KkhWetbai`l`n`o`p`qararas`t^t[uZt\p\n\n\n\n\n\n\n\nu qi!m(u1 z:'{C1{L=xXJreWkqcf|lcrbuavbwbxbybzb{`|]}Z~\y^t^s^s^s^s^s^s^s^sv rj!q'z09%B/K;VHybVrmdkxofwd|c~ccccƒcЅ`؆\܇]߃_~`yawawawawawawawaww sk u&~/8#A-J9UF`Uzkdsuqk~|fddccbb̏a֏_׎`ۉb߄c~c|c|c|c|c|c|c|c|x tl y&/8!@*I6SD^ShczqrqzjfddefhǔgӔcӔd׎fۉg߃gၳgၳgၳgၳgၳgၳgၳgy t o}&.7@(H4RB\Qfbnrxvo}ihhikllИhИhӔi؎j܈jޅjޅjޅjޅjޅjޅjޅjޅy u r%.7?&G2P?ZOd`lq؀swzpmmnopqʜm͜lЙmԓnٌnڊnڊnڊnڊnڊnڊnڊnڊz v u%-6?#G/O=YMb_ڐjpчqww~rqrrstàqˠo̝pїqՐq؎q؎q؎q؎q؎q؎q؎q؎{ w x$-6>!F,M:WJޝ`]Ԗhnˎo}Æu~{xvvvwxvȣsɢtΛtҕtԒtԒtԒtԒtԒtԒtԒtԒ{ x z$-5=E*L8VH٣^[МgmƔm|sy~{yz{{{ƦvƦv˟vИvіvіvіvіvіvіvіvі| x |$,5<D'K4߭TEը]Yˠeklzrw|}}~~êyĪyȣy͜yϙyϙyϙyϙyϙyϙyϙyϙ| y $,4;C$J1۱RCѬ[Wƥcijxpuy}|Ƨ|˟{̝{̝{̝{̝{̝{̝{̝{̝} z # +3;B H-׶PA̰YVªahhwnsw|~zyêzȣzʠzʠzʠzʠzʠzʠzʠzʠ~ z  # * 29@޾F*ӺO@ȴWT_ffukquy~zwutqp¬rǥrȣrȣrȣrȣrȣrȣrȣrȣ~ {  # * 1 8?C(οM>ùUR]dcsinrv{zqmlkji¬jƦkȤkȤkȤkȤkȤkȤkȤkȤ|  ")/ 6 <@&K#H9QMW_]ob|fjxnlse}cbba`Ǥ`˟a̞a̞a̞a̞a̞a̞a̞a̞  $'(, ; E6MJT\Yl]ya{eoieo`{_^^]\̞\Ϛ\И\И\И\И\И\И\И\И/ :C2JFPXUhXv}[q_fc^l[yZZ™YīYſWіXԒXՑXՑXՑXՑXՑXՑXՑXՑ2 <B.GALTOdRrsU~gX^^YhWwVӇVԘUժT׾SٍSۉT܈T܈T܈T܈T܈T܈T܈T܈"2:>.B?FOJ^vMkjOv_SXZTeSsR䂅Q哄Q棃P終ÓOO~O~O~O~O~O~O~O~ Ӻ %06:.>fJ=pI?>;D>9J?7P?6W>5^>4f=3o<1{;1;1;1;1;1;1;1;1;Ÿ{ pf\S#L(F$,A'/<+19037535943>41C4/I4.N4-T3,[3*c2*f2*f2*f2*f2*f2*f2*f2*f2yn cYQ IB"=%9'6#)3&*1++//+-3++7+*;+(?+&D+%I*#O*#Q*#Q*#Q*#Q*#Q*#Q*#Q*#Q*f ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLf ^T%Q-"V4&W<-UG6RT>ObENqINKOKOLPLQLQLRLSLSKTKTLTLULULTLSLSLSLSLSLSLSLSLg _U$T,!Y2%[<,YF5UR>R`EPoKP|MPNQOROSOSOTOTOUOUOVOVOVPVPUPTPTPTPTPTPTPTPTPh `V$X*^1$a;+`E4[O=X]FUlMTyQSSTTUUUUVUVUWUWVXVXVXVXWWWVWVUVTVTVTVTVTVTVTi aW#\)c0"f9)fC2bM<^[FZiOWuUVXVZWZW[X[X\Y\Y\Z]Z]Z]Y^X_W]XYXYXYXYXYXYXYXYj cY#a'h/ l8'lB0iL;eXF`eP\rXY~]Y_YaZaZbZc[c[d[d\e[fYfXfYbZ^Z^Z^Z^Z^Z^Z^Z^k dZ#f%n.r7$rA.qJ8mVDgbPbn[^zb\f[h\i\j\k\k]l]m]n\oYoZk\g]c]c]c]c]c]c]c]cl e_!k$s-x6"y?+xI6uSBp_Oik\cvf_l^p]q]s]t]u]v]w]xZz\v]q^m_h_h_h_h_h_h_h_hm fco#x,}5>(G3~Q@x]Nqg\jrhd{r`w_{^|^~]^_ƀ`؀^_|`warbmbmbmbmbmbmbmbmn hgt#},4=%F0O=ZKze[rniiwvc``abcddхcޅbc}dxerererererererern ijx"+4<"E-M:XIbYzkiprxizeeefghiɊiڊf܈gh}hwhwhwhwhwhwhwhwo jn|"*3;D*L7WF`VقhgypvqwljjjklmnՏj؎k܇kl|l|l|l|l|l|l|l|p kq!*2;C&K4VBܑ_TӉgeˁntyts{onnopqqΓnԓoٌo݇oလoလoလoလoလoလoလoq kt!)1:B#J0U?ח^QΏecňlrrzxurrsttuȗrїrՑrڋrބrބrބrބrބrބrބrބq lw! (19A I,ܢS<Ҝ\Oɕdajpp}u{|wvwwxx›vΚuҖu֏tۈt܈t܈t܈t܈t܈t܈t܈r my ! ( 08?G(اQ:ΡZMĚb_inn{sy|zzzz{z̞wϚwӔwٌwٌwٌwٌwٌwٌwٌwٌs n| ' / 6>ޯF#ԫO8ʥYK`]glmzrv|~}}}~~ɡ{̞zЗyՐy֐y֐y֐y֐y֐y֐y֐s o~ ' - 5<۳C!ЯN7ƩWJ_[ekkxpty}|zŤw~ɢx}Λx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕx|Ӕt p  &, 3 :ַA ̳L5UH]Yciivnrv{xusqpnǤo̞pїpіpіpіpіpіpіpіu r $*0޻6 Ҽ?ǷJ2SE[WaggtkptyxokjihfȤg̞hИhЗhЗhЗhЗhЗhЗhЗv u "&+. =½H0QCXT^ddrh~l}qrui}edccaʠbΛbҖbҖbҖbҖbҖbҖbҖbҖw y  ޿ ):E-N@UQ[a`oe{ivmkrc{``__^Κ^і^Ց^Ց^Ց^Ց^Ց^Ց^Ց^Ցx~ %7B)K=RNW^\l`xxdmhcn^x\\[ZZғZ֐ZڋZڋZڋZڋZڋZڋZڋZڋy  2?%G9NJSZWh{[tp^eb]jYvXXWVVъU܈V߄V߄V߄V߄V߄V߄V߄V߄{  Է"3GKDKGKMDSNC]OBgNAsM@L@K?J?I>G>G>G>G>G>G>G>GԤȳ {q#g'$^+,U/3O38I8JA5=5<5<5<5<5<5<5<5<ʮ y oe[ S#&L'+F+/A02=54::67@64F73M61T60\5.e5-o4,y3+2+2+2+2+2+2+2+2vl b YPI C$="'9&*5*+2/,04--9-+>-(D-'K,%R,#Y+"a* k) k) k) k) k) k) k) k)ti_ VMF ? 94!1".#+$$)(%',%%1%#6% ;%@$F$L#S"S"S"S"S"S"S"S"YOE'F-!I3%I<+GH2EU8CcJ>J>K>K=L=L=M=M=N=N=N=N=N=N=N=N=N=ZQF&L*P0#Q:*OD1LQ9I^>HmBH{CICJCKCLCLCMCMBNBNBOBOBPBPBPBPBQAQAQAQAQAQAQA[RH&P(U."W8(UC0QN9N\@KjDLxFLGMGNHNGOGOGPGPGQGQHRHRHRHRHRFSDSDSDSDSDSDSD\ SL$U'Z- \7&[A/VL8SY@PgGOtJOLPMPMQMQMRMRMSMSNTNTNTOTOTNUKUIUIUIUIUIUIUI^ TP"Y%`,c6$b@-_J6ZV@VcISpNS}QSSSSTTTTTTUUUUUVVVVWVWVWWSXPXNXNXNXNXNXNXN_ VU _"g+j4!j>*gH4bS?]_IYlRWxWVZV[V\V\W]W^W^W_X`XaWaY]ZZZV[S[S[S[S[S[S[S` WYd!m*q3q<'oF1lP=f\I`hT[s\Y~aXcXeXfXgXhXiXjXkXlZh[d\`]\^Y^Y^Y^Y^Y^Y^Ya X^j s)w2x;#xD.uN:oYGhdTbn`]yg[lZnYpYqZq[q\q]q]q]o_j`f`ba_a_a_a_a_a_a_b Zbo x(}1: C*~K6yWDraRjkabsl]}t]v]w^w_w_w`wawawavbqclcgddddddddddddddc [gt}'09A&J2U@{_Psg`jomdxvbza|b|c|c|d|e|f|e|ewfrfmgigigigigigigid ]jx&/7@"I.T<ۃ]L{e]smlltvh|}ffghhij́jၪi|iwjrjnjnjnjnjnjnjne ^n{ & .6?G*ޑS8Պ\J͂c[{jitqunx~kkkllmmƅnچmm|mwlslslslslslslsf aq  % -5=F%ڗR5АZGljbXhg{otuu~q|ooopqqrԊp݇pၔo{owowowowowowowg dt  $ + 4<ߟE ՜P3̕YEŽ`Vgemr|r}wytsssttuΎsٌsޅrq{q{q{q{q{q{q{g fw #* 2 :ۤCѠN0ǚXC_Teckpp{}vy|wvvwwwȒvՐuۊt߄ttttttth i z ")0 7بAͤL.ÞVA^Rdainnzs~yzyyyzzÖyҕ~x؎~w܈}v߃}v߃}v߃}v߃}v߃}v߃}v߃i k |!'-ެ4 Ӭ?ɨK,T?\Oc_hlmxqv|}}|{}y}w~u}ϙu|Ԓv{ًuy݇uy݇uy݇uy݇uy݇uy݇uy݇j n  $)۱.ϰ=ŬI*RdD=qC<~A;@;?;>:=:<:<:<:<:<:<:<ϤIJw md"[&"S+)L//F43A:6=@8:G98N96W85a84l72y514030201010101010101Ů~tk aYPJ"#C&'>+*90,66.3<.0B/.I.,Q.+Z-)d,(o+&y*%)$($($($($($($(|qg^ V MF?: 5!#1%$.*%,/&)4&&:&#@&!H%P$X#`#j"q!q!q!q!q!q!q!|od[R JB;5 0,)&#!!&+06<CIQWWWWWWWKA8)=, ?2#><(0?/?/@.@.A.A-B-B,C,C,D,D+D+D+D+D+D+LB;(A*C0#B9(AE.>R2=`5=o6=}5>5?4@4A3A3B3B2C2C2D1E1E1F0F0F0G/G/G/G/G/G/G/MC>&D(G."G7'EC.BP3A^7@l8@z8A8B8C7D7D7E6E6F6F5G5H5H5H5I5I4J3J2J2J2J2J2J2NDB$H'K, L6&KA-GN4E[9Di;DwGs@H@I@J@J@K@K@L@L@M@M@M@N@NAO?P=Q;Q;Q;Q;Q;Q;Q;QFJ R"X)[3"Y=)UH2PT;MaALoDL{FMFMGNGNGOGOGOGPHPHPIPIQHSETCT@T@T@T@T@T@T@RHOX_(b2a;&^E0XP:T]BQjIPvLPMPNQOQOQPRPRQRQRRRSRSUOWLWIXFXEXEXEXEXEXETIT_g'j0j:#gC,bM7]ZBXeKUqRT|USWSXTYTYTZT[T\U\U\V[YWZS[O[L[K[K[K[K[K[KULYem&q/r8pA(lK4gW@`aL[lVWv\V`UbVbWcWcXcYcYcZcYc\^^Y^V^R^Q^Q^Q^Q^Q^QVP^ks%x-y6x?$vH/qTF*zR8t\GldVemb`uj_m_n_n`n`nanbobobodkdfebe]e\e\e\e\e\e\X Xg t }# *3<E%݃Q3|ZCtbTmiagqkdzpcscsdtdtetetftftgrhlhghchbhbhbhbhbhbY \k x " ) 1:D ؊O/σXA|`Qug_onjjurh~vhxhxhxixixjyjykwkqkmjhjfjfjfjfjfjfZ _o {!( / 8ݔCӏN,ʉW>^N|e]vkiqrrnyxl{l|l}m}m}m}n}n}nwmqmllklklklklklk[ b r &- 5 ٙAΔL*ŎU<]LcZ}igworsvyq}~ooopppŁpۂp{pvoqoooooooooooo\ e u$+ߝ2 ԝ?ʘK(T9[IbXhe~mpyryuysrrssssֆs rzquqsqsqsqsqsqs\ g x!'ۣ-С=ƝI%S7ZGaVfckn~pxzuw}uuvv~v}vъ|vބ{u~ztyzswzswzswzswzswzsw] j z!צ*̥;¡H#Q5YE_Seailnws{y}yzyxyvytzszˍsz܈sxrw|rv{rv{rv{rv{rv{rv{^ m }ޥҪ'Ȩ9F!P2WB^Qc^hjlup{ut~}p}n}l~k~iǏjڋj}ޅj{jz~jz~jz~jz~jz~jz~_ p٪ έ$ì7DN0U@\Nb\fhjs}n}trlygedcbĎbڋcޅccccccc` t  إҮȲ!5 BK-S=ZK_Ydehpwl{npew`_^]]Ê]܇]]~]}]}]}]}]}]}e x ٠ҩ˱¶1 ?I)P9WH\Uab{emqixgn_u\[ZZYÃY܁Y}YyYxYxYxYxYxYxi}ܙӤ̭Ķ-;E&M6SDXQ}]^taijesak|ZsXWV~V}U{UzUwVsVrVrVrVrVrVro֞ͩŲ(7A!I1O?TMvXYl\ebanZguVqxT~xSwSuRtQrQqQnRkRkRkRkRkRkRkuڗУǮ!1 <D+J:wNGmRTcW_Z\gTdlQonP|mOlOkNiMhMgMeMbMbMbMbMbMbMb~ӝɩ* 6>%xD4nHAdLMZQWSW^O`aMlbLzaK͉`KΙ^Jϫ]I[HZHYIWIWIWIWIWIWIW̥ٗð'0x7 n=-dA9[FDSKMMRRJ\THhTHvSGQGPFOEMDLDKCJCJCJCJCJCJCJޏПŬ$ w+m1c5)Z93R>;KEAGMEDVFCaFBnEA|DAC@A@@??>>>=><><><><><><ԙǨ~u l$b)Z.%R3,J82E>6AE9>M:6-:'*E&(N&&W%$b$"n#!z"! xlbZR JC <61. *%(*$/!5<DMV`jvyyyyyyxk_VNE > 72- ($!!&+1 9 @HPY[[[[[[>4"1(5+61!4;%2G(0T*0b*0q*0~)1(2'3&3&4%5$5$6#6#7"8"9!9!9 : : ::::::?5!4'8)9/ 89%6E)4R+4`,3n,4|+4*5*6)7(7(8'9'9&:&;%;%<$<$=#=#=#>">">">">">"@6!7$<'=, =7$;C)9P-8].7k/8y.8-9,:,;+;+<*<*=)>)>)?(?(@'@'A'A&A%A%A%A%A%A%A7 ;"@$B*C4#A@)>M.0?/@/@.A.A.B.B-C-C-D-D-E+E*F)F)F)F)F)F)B8 @E"I(J2!H=(EI.BV3Ad5Aq6A~6B5C5D5D4E4E4F4F3G3G3G3H4H3I1J/J.J.J.J.J.J.C;DKQ'R1P;&MF-IR4F_9Em;Fy;G;G;H;H;I;I;J;J;J;K;K#dH._T9Y^DUiLStQR~SRTSTSTTTTTUTUTVTVUWRZM[J\G\D\D\D\D\D\DIN[g n"r)s2r<nE(iQ5c[B\dNXnVWxYWZWZX[X[Y[Y[Z[Z[Z[[Y]T_P_M_J_J_J_J_J_JJS` l t x( z0z9xC#sO/mY?eaM`jW]s]\|`\`\a]a]a^a^a_a_a_ab[cWdSdPdPdPdPdPdPLVe qy~& . 7A|M*uW;n_JhfWcn_awd`f`fagagbgbgcgcgcgfbg]gYfUfUfUfUfUfUMZ i u}$+ 4ۈ@уL'|U8v\HodUjk_gsfe{jekekelflflflglgligibi^hZhZhZhZhZhZN] lx"(0 ֍>̈J%ÂS6|[EwbSqh^mogjvlioipipipiqjqjqjqkmkgkcj_j_j_j_j_j_O` p{%ܓ,ё<ǍH"R3YB}`Pxf\slfpsnmzrltlululululumvnrnlmhldldldldldldRc s  ؗ)͕;ÒG P0X@^N~dZyjetonqvto~woxoyoyoyozozpwpqolnhnhnhnhnhnhT fv ߗӛ'ə9FO.W=]KcXhczmmvrtsyyr|q}~r}}r~{r~yr~ys{ysuxrpwqlwqlwqlwqlwqlwqlW ix ڛ Ϟ$ŝ7 DN,V;\IaVfakk{ot~wv{zu~wuuusuqupvÁowpvyputotootootootootootoZ l{  ٘Ԟʢ"5 BM)T8[F`Sd_ijmsx}r|qzymykyizhzfzf{؂g{{gyvgwrgwrgwrgwrgwrgwr] oۓԛϢŦ3@J&S6YC^Pc\ggzkqqo{ivdba`_^ԁ`|`w`}s`}s`}s`}s`}s`}sas֗ϟɦ0>H#P3W@\MaY}edtiokmxcs^}\[[Z~Y}[y[u[q[q[q[q[q[qewڑқʣª,;E M/T=YJ^Vxcangkekt^r{Z}}X|X{WyVxVwWsWpWmWmWmWmWmWmi|Ֆ͟Ĩ'7BJ+P9VEz[Qq_]gcg_ioYqtV|uUuTsTqSpRoSlTiTgTgTgTgTgTgoڏЛǤ"2 >F&L4{RArVLiZX`_aYfhTolR{lQkQjPhOgOeOcOaP_P_P_P_P_P_vԕʠ,8A |G.tL;jQGaUQYZZSb`OlbNyaM`M_L]K\KZKYKWKUKUKUKUKUKU~ڎΛħ #1 }:tA'kF4aK?YOIRUPM^TKiUJvUIƅSIƔRHǦPGȹOFNFMFKFJFJFJFJFJFJӖǣ|)t3k: a?,XD7QI?KQEHZGFfGEsFE؂EDْDCڣBC۷AB@A?A?@>@>@>@>@>@>ُ˞zr$ i+`1W6&Oy8>7=6=4<3;2;1:1:1:1:1:1:1ϙçwog _$V)O/!G4'B;,=B/:J08T07_/6l.5z-4+4*3(3'2&2%2%2%2%2%2%Ƥtld\ TM!F&?+ :1#68%3?&0G&.Q&-[%+g$*v#(!( ''&&&&&&ti`YQ JC<7!2'/-+3(9%A#J!T`m{th]UMF >8 2.*& #& +18AJU` k wuh\QIA9 3 .($ !' -5>GPYaaaaaa1'&*',*,1): &F"%T#%b"%p!%} %&'(()**+,-...........1'&-%/(/.-8!+D#*R$)`$)n#)z")!* +,,-../01222222222223)$0#4%4+36!1B$/O&.]&.k%.x$.#/"0!1!1 233456667777777774-!5 8"9':3 8?$5L'4Y)3g(3t(4'5&6%6$7$8#8#9"9":";!;!A&B0@<$(>(?'@'@'@'A'A&B%B$C#C"C"C"C"C"77@DI$K.H8"ED(AQ-@^0?k1@w0@0A/B/B/C/C.D.D.E.E/E/F/G-G+H*I(I(I(I(I(I(8<ELR"T,R6M@&IL.FY3Ef5Er6F}6F6G6G6H6H6H7H7I7I8I8J6L4M2M0N.N.N.N.N.N.:ALU[!]*[3W="RH,NT4K`9JmK>L?L?L?M?M?N?N@O>P;R8R6S4S3S3S3S3S3;FR\ c e(e1a;\D'WQ2S\;PgAOrDO|EOFPFPFQFQFQFRFRGRGSFUBV?WtJ$nS4h[BccM_lT^tW]}Y]Y^Y^Z^Z_Z_Z_Z`[aWcRdNdKdJdJdJdJdJHX f qy~$ނ-Ԁ<{H!vQ1pY?j`KfhTcpZbx]b^b_b_b_c_c`c`c`d^fXgTfPfOfOfOfOfOK [j u|ه)υ:ŁF|P.wWG!N.~S:vXFn]Pea[]gcWohTyjSiRhRfQePcPaQ^Q\Q[Q[Q[Q[Q[pԍʘ-9CI)wO6oTAfXK^]TWd\Rl`Pw`O`O^N\M[MYLXMVNTNSNSNSNSNSv܆ϓŞ&4 =xD#pJ0gO;^SEWYMQ`SMiULuUKTKSJQIPINHMHKHJHJHJHJHJHJ~ԍɚ,x6p>gD(^I3WN=PTDK\HIfIGsIGGFFFEECDBDAC@C?C?C?C?C?C?܆͕áy t n- f6^< VB*OH3IO8EX;Dc3=3=3=3=3=3=3ӏƝzojc$ [,T2L9"F@(BH-?Q.=\.=i.7!:>$7G%5Q%4\$3i#2w"1!0//.......|pe]V P IB!;'6-24/;,D*M)X'd%s$#"!!!!!!!}peZSLE > 82."+('.$5 =FQ]k{~qdYNG@94 . )%"!&-4= GS_ly rdXMC;4.) $    ")1; F P Z e h h h h h $'#'$)!09FTao| !!! ! ! ! ! ! ! ! ! %!%%$''%-!7 DQ_my  !!"##$%&&&&&&&&&&&&$")!+#*))4&A%N$\$j$v$%&&''())++,,,,-,,,,,,'(.0 0&11.>,K!+X!*f *r+~,--../001223333333333(-479#:.8:4G"2T$2a#2n"2z!3 44566788999:::;;;;;;*3:?C!C+A7=C#:O&9\'9i&9u&:%;$;$<#<#=#=">"?"?"?"?"@!A ABBBBBB-9AGL M)J3F>!BJ'?W*?d+?p+@{*A*B*B*B*C*C*C*D*D+D+E*F)G'G%H$H#H#H#H#H#2?GP VV&T0P:KF%GR,F^/Ek1Fv1F1G1G1H1H2H2I2I2I3J3J3K0L.M,M*N)N)N)N)N)7CN X ] _% ^-Z7TA!PN*MY2Ke6Kp8Kz8L9L9M9M9M9N:N:N:O:O;P8Q5R3S1S/S/S/S/S/<I T _eg" g* d3`?[K%VU2R_:Qj=Qs?Q|@Q@Q@R@R@RASASASASBT?Vo_HjeQglVfsZe{\d]d]e^e^e^e_e_fZgUhQgNgNgNgNgNQ`nw~Ղфȇ2?I!|Q/xW;t]FpcPliWio\hw_gagbgb~gc}gc{gcygdzi_{jZ{jUziRziRziRziRziRScqz؁ц̈Ë0=HO,~V9y[DuaNqfWnl]lsb|k{ezjfxjgvjgtjgrjhpjhqldrm^rlZrkVrkVrkVrkVrkVVgs}Ԅ͉nj-<FN)T6ZAz_LvdU}si^xpodtnwhqnjonkmnkknkinkgnkhohjpbjp]jnZjnZjnZjnZjnZYjvڀчɌ+: DM&S3X?]I|bSxyf]qvlelssjhr|merncrnbrn`sm_sm_tjaudbt`br\br\br\br\br\]myփ͋Ő(8 CK#R0W<\Fz`Qsd[k|iddzoj`xxn]xo\xo[ynYymXykYziZzd[y`[x][x][x][x][x]`q}҇ɏ $5AI P-U8}ZCv^NnbXfga^mhYvlWlVkVjUhTgTeUaV]V[V[V[V[V[duف΋œ1=GN)S5xX?p\JhaT`e\YlcUufSfSeRcQbQ`P^Q[RXRVRVRVRVRViyԆʐ,9 CJ$zP0rU;jZEb_O[dWUk\Ru^P^P\O[OYNWMVNSNQNPNPNPNPNPoϋŕ&5 ?{FsL+kQ6cV@[[HUaOPiTNtUMTLRLQKOJNJLJJJIJHJHJHJHJHvօʑ.z9sAkG%cL/\Q9UWAO^GKgIJrJIIHGHFGDFCFAF@E?E?E?E?E?E?~όĘ|x&r2 k;cA[G(TL1NR8IZEo=D|ʈ->ʘ,=˪*<);(;(9)9)9)9)9)9)͏ui_[V&P/J6D>?F >>???@AAAAAAAA0;B K P P$M,H7CC@P#@]$Ai$Bt$B}$B$C%C%D%D%D&E&E&E&E'F&G$G#H!H H H H H 6@ J TXY W) R3M?JL"HX'Gc*Gn+Hw,H,I-I-I-J-J-J.J.K.K/K-L+M)M'O&O&O&O&O&; F Q[`a`%\. X<THPS)N]/Mg2Mq3My4N4N4N4O5O5O5O5O6P6P5Q2S0T.T,T+T+T+T+? KWa fhg d*b9^EYO)UX2Sb7Rk9Rt:R|;S;S;S;TWn@WvAW~AWAXAXBXBXBXCXCXCY@Z<[9[7[6[6[6[6F Sainpo r"q4 nAiJ#dS/`Z9^b@\jD\rE[yF[G[G[G[H[H[H[I[I\F]B]?^<^;^;^;^;JXdlqttww2t>oH kQ-gX8d_@aeF_mI^tK^|L^L^M^M^M^N^N^O^L`G`DaAa@a@a@a@M[houxy{|/y=uGqO*mV6i\?fbFciLbpOaxPaQaRaRaSaSaS~aT}aQ~bL~cH~dE~dD~dD~dD~dDP^jsy|}-~;zEwM'sT3oZ=k_FheLelQdsTd{V~cW|dW{dXydXwcXvcYudWveQvfMwfIwfIwfIwfIwfISbmv|ʀÁ+9 D|L$xR0tX;p]DmbLjhR{hoWxgwZvf[tf\rg\pg\og]mf]lg[mhVniQoiMoiMoiMoiMoiMUepy΀Ƅ(7 BJ"}Q.yV8v[Br`KyoeStlkYpks]mj|_kj`ij`gj`fj`dj`ck_elYflUglQglPglPglPglPXhs|ʃ‡%5@IO+U6{Z@{x^ItucRnrhYhpo_enxbbnc`nc_oc]oc\ob[oa]p[^qW_pS_pR_pR_pR_pR[kwЀLJ "2>GN'S3}X=v~\Fo{aPhxfXbvl_]tucZtdYtdXucWubVuaUv`Vv[XvWXuSXuSXuSXuSXuS_n{̄Ë/<EL$Q/yV:q[Cj_MbdU\}j\W|s`U|~aT|`S}_R}]Q}\Q~[R}WR}TS}QS|PS|PS|PS|PdsȈ,9 BJ {O+tT6lY?d]H]bQWiWSr[Q}[PZPXOVNUNSNQNNOLOLOLOLOLix΄č&4?|GuM'nR1fW;_[CXaKShPOqSN}RMQMOLNKLKKKIKGKEKEKEKEKEo~ʉ /|: uBnI!gN,`S5YY=S_DNgHLqIK}IJGIFIDHBGAG@G?G>G>G>G>G>vЄď~z(t4 n=gD`J%YO.RT6M[;Id>Go>F{>FXDQI&KP,GW1D`3Bl3Ax2A0@/?-?,>*=*<*;+;+;+;+;+Іēxkc`![-U5O<ICDJ!@R$>\%61,($  $ + 4 > I Vewwj]QG<3,'" "*4?L[k|zl^QF;1(!  )4AN[hvxxxx '$$&,6DR_l x %!!# ) 4BP]j v                   "%1>LZ f r }     ".;HVcoy            #'&*)+&7#D!Q!^ j u!"# $ $ % & & ' ( ( ( ( ( ) * ) ) ) ) ) "*.254&13-?+L*Y*f+q+{,-..//011 1 1222222222(1 6 = @ ?#;-7:3G2T3a4l5v66777889999:::;;::::.7 > FJI E)@4>>???@@@@AABBBBBBB3 = FO RRO% J/ F<DICVCaCk Dt!D|!E!E!E"E"F"F"F#F#F#G#G"H IJIIII9 BNV ZZXS)Q8MEKP!J[%Ie'In(Jv(J~)J)K)K)K*K*K*L*L+L+M)N'N%N$N#N#N#N#= GT[_ _]\%[5 WBSL!PV)O_-Oh.Oq/Ox0O0P0P0P1P1P1P2Q2Q2Q0R.R+R*R(R(R(R(AMY`cca d!c2 _?[I XR)UZ0Tc3Tk5Ts6T{6T7T7T7T7T8T8T8T9T7U4V1V/V.V.V.V.EQ]chigjj0g=cG_O(\W1Z_6Yf9Xn;WvW>W?W=X:Y7Y4Y3Y3Y3Y3HU`gmomop-m:iEfM&bT0_[7]b<[i?[q@ZxAZBZBZBZCZCZDZDZC[?\<\9\8\8\8\8KYclqsrtu+s8 oClK#hR.dX7a_=_eA^lD]tE]|F]G]G]H}]H|]Iz]Ix\Iy^Dy^@y_>y_{FxM&tR0qX9{n\AukbHphhNmgoRjfxTgfUffVdfVbfV`fV_fV`gQahLbhIchGchGchGchGVeqy0<D}K#zQ-}wV7vt[?pq_HjneOellTaktW_j~Y]kY\kXZkXYkWWkWXlSZlN[lK\lI\lI\lI\lIZiu}-9 BI O*x}T4rzY=kw]EdtbM^riTZqqXXp{YVpYUqXTqWSqVRqURrQTrMTrKUrIUrIUrIUrI^mxǁ)6 @GzM&tR0mW:f~[B_|`JYzgQUxoURxyVQxUPyTPyROyQNyPNyMOyJOyHPxFPxFPxFPxFbr}Æ%3=|EuK#oP,hU6aZ>Z_FTeLPnONyPMOMMLKLJKHKGKDKCKBKBKBKBhwɂ /}: vBpIiN(bS1[X9U]@PdEMmGKxGJFJEICHAH@G?G=GiEcK"\P+VV3P\9Lc=Im>Hx>G=G;F9E8D7D5C5C4C4C4C4C4v˃}v s!n/h8 b@[FUL$OR+JY0Ga3Ek4Cw3C2B0B/A-@,?+?+>+>+>+>+>+}Ŋzmgd&_1Y: S@MGHM"DU&A](?h(>t'=&=$<#;!: :8 7!7!7!7!7!ˆtf[WT'O1J9 E@@G-:6 6? 3H2R0]0j/x .Έ -Ι ,ϭ + * ( ' &&&&{obWLB730-'*1(;&F%Q$]#l"|! ~qdXMC9/,(%!#,6@LXhy    seYNC9/'# % . 8DQattgZNC8.% $.:HYl~wi[NB7-# #/>N_o|$ " "$*5C Q ^ kw " !&2@ N [ ht~ #0=K X e pz     ,9G T a l w    " )5BO\ h s |       $ & + - ,$(0$="J!W !c "n #x $%%&&''((()*** * * * * * * %+ / 78 7 3+.8,E+R+^ -j .t /} / 0 0 1 1 2 2 2 3 3 3 4 3433 3 3 3 + 2 :A CA=& 81 4?4L5Y6e7n8w899:::;;;;;;<;;<<<<1 8CIKJF @+>9 =G>S>^?h?q@y@@AAAAABBBBBCCCCCC6>IOQPMK%I5 GBFNEXEbEkFsFzFGGGG G G G!H!H HIIHHHH;DOTVUP T!S1Q>NILS K\#Ke$Km%Ku%K|&L&L&L&L'M'L'L(L(L(M%M$M"M!M!M!M!?ITY]]Y\\.Y;VFSO"QW'P`*Ph+Po,Pw,P~,P,P-P-P-P.P.P/P/P,Q)Q(Q&Q&Q&Q&BNW_cd`bc+`9 ]CZL!WT(U[-Tc0Tj1Sr2Sy2S2S3S3S4S4S5S5S6T2T/T-T+T+T+T+ER\dhjggh)g6 cA`I]Q(ZX/X_3Wf5Wm6Vt7V|8V8V9V9V:V:~V;}V;|V8|W4{W2{W0{W0{W0{W0GU`hmnlln&l4i?fGbN&_U.][4[b8Zh:Yp{Y>yY?xY?vY@tX@tY=tZ9tZ6tZ4tZ4tZ4tZ4JXdlqsqp r#q2o=kEhL$dS-aX4_^9}]d=z\k?x\sAv\|Bu\Bs\Cq\Co\Dm\Dk[Ek\Bl]=l];m]8m]8m]8m]8N\hptvuu v v/s; pCmJ!jP+gV3{d[9wba>s`gBp_oEn_xFl_Gj_Hi_Hg_He_Ic_Ic_Fd`Ae`>e`;e`;e`;e`;Q`ksxzzyzz-x9 uBrIoO(|lT1viY8qg^?ledDickHfctJdb}KbbL`cL^cL]bL[bL[cI\cD]dA^d>^d>^d>^d>Tdov{~~}~~*}7 z@wG}uM%xrR.roW7ll\>fjaEbhhJ^gpM\gzNZgNXgNWgNVgMTgLTgJUhFVhCWh@Wh@Wh@Wh@Xhrz'4>}Ey{K"sxP+mvU4gsZG~=G};G|:G|9G|9G|9G|9hvĀ|)v5p=jDdJ^O'XT/RZ6Ma;Ji=Ht=G+>+>+>+uƂyojf)b3\< VCQIKO!GV&C^)Ah*@s)?(?&>%=#<"3*"$.9 F Sct~pbVJ>4*" &1>L]prdWJ>3)   '5DVi}tfXK>2(*:L_q"" ( 3 AP]iu~ $ 1 > MZfr{    " . ; IVbnx   * 7 E R^jt}         ' 3 @ N Z f p y    # % #" . ; H Ualu} """""!!!! % */ 0.*) %5 #C "P#\$g%q&y'(())**+++,,,,, + + + + ' ,5:;83"..+<-J.W0a1k2s 2{ 3 3 4 4 4 4 5 5 5 5 5 5 5 6 6 6 6 6 -3<AB@;6&767D 8Q 9[:e:n;u;|;<<<<<===========3:CGGD> B!B1A?@K@VA_AhAoBwB}BBBCCCCCCCCCCCCC7@IMPOHLL.J;HFGPGYGbGjGqGxGHHHHHHGGHHHHHHH;EMUXXQTU*S7 PBNKMTL]!Ld"Ll"Ls"Lz#L#L#L$L$L$K%K%K&K$L"L!L LLL=IT[__ZZ\'Z5 W?UHRP!QX$P_&Of(On(Ou)O|)O)O*O*O+O+O,O,O*~O(~O&}O$}O$}O$}O$@MYadea`a$`2^=[EXM!UT&T[*Sb,Ri-Rp.Rx.R/R/R0}R0{R1zR1xR2wR0vR-vS+vS)vS(vS(vS(DR^eijge f!f/c:`C]JZQ&XW,W^/Vd1}Ul2|Us3zU{4xU4wU5uU6sU6qU7pU7nU6nU2nV/nV-nV-nV-nV-HVbimnljkk-h8 eAbH_O%]T,|[Z1yY`4vXg6tXo8rXw9pX9oX:mX:kX;iX;gXf[>d[?c[?a[?_[@^[?_[:_\7`\5`\4`\4`\4N^ipuvurss(r4o=mD|jK!wgP)qeU0lbZ6ha`;e`g>b_pA`_yB^_B\_B[_BY_BW_BV_BW_=X_:Y_8Y_7Y_7Y_7Sbmtxzzwwx%w1t; ~rCxpIrmN&mkS.ghX5bf^;^dd@ZclCXcvDVcEUcDTcDRcCQcCPcBQd>Rd;Rd9Sd8Sd8Sd8Xfpx|~~{{|!{/z9 zxAtvGnsM#hqQ,boV3]m[:Xkb?TijCRisDPiDOiDNiBMjALj@Kj?LjIq=Hr;Gr:Gq8Gp7Gp5Go5Go5Go5boy{'v3p< jCdI^N$Y~S,S|X2N{^7Kzg:Iyq;Hy|:Gz9Fz7Fz6Ez4Dz3Cy2Cx1Cw0Cw0Cw0Cw0ht~xt"o/j8 d@_FYKSQ&NV,J]1Gf3Ep3D|2D1C/B-A,@*@*?*>*>*>*>*nzzplh)c4^< XCSINN IT%E\)Ce*Ap*@|(@'?%>$=" LEGLCR@Z>d %I$S#_"l!{ug[NB6," !,8DP^ n  ВЧxj]QE9.%  #/<K[m{m_SF:/$ &4EVi}~oaTG:/$ +=PdxqcUH;.$!3G\o    $2@N[fqz    ! /=KXcnw     +9GT`kt|      (5CP\gpy     #0>KWblu}       +9 F R ^ h q y  #('$ %2@MYcmu|  !""###$$$$$$$$"%-10-("*"9%G'T(^*g+p+w,},----......//....(-6872,-#/31B2N3X4a4j5q5x 5~ 6 6 6 6 7 7 7 7 7 7 7 7 6 6 6 6 .5<?A>69:.:< :H ;R <\ >>>>========1;BJLIBDE)C7 BCBMBVB^BfCmCtCzCCCCCCCBBBBBBBB4@KRTSLLN&L3J>IHHQGYG`GhGoGuG|GGGGGGGGGGGGGG9EQX[[TRU"T0R;ODMMLTK\KcKi Kp Kx K!K!K!K"K"}J#|J$zJ#yK!xK xKxJxJxJ=LW^aa\Y ZZ-X8 UARIQPOW"O^#Ne$Nl%Ns&}N{&|N&zN'xN'wN(uN)sN)rM)qN&pN$pN#pN"pN"pN"AQ\bffb^__+]6 [?XFUMTS$}RZ&{R`(yQg*wQo*uQw+tQ,rQ,pQ-oQ-mQ.kQ/iP/iQ+iQ)iQ'iQ&iQ&iQ&EU`fjjgcdd(b4`=]DZK{XQ$wVV(tU\+qTc-oTk/mTs0lT|1jT1hT2fT2dT3cT3aT4aT0aT-aT+bT)bT)bT)IYdjnnlhhh%g1e; bB{`Hv]N#q[T(mYY-jX_0hXg3eWo4dWx5bW6`W6^W7\W7[W7YW7YW4ZW1ZX.[X-[X-[X-N]gnqrqllm"l/j8 |g@veFqbL!l`Q(h^W.d]\2`\c6^[k8\[u9Z[:X[:W[:U[:T[:R[9S[6S[3T[1T[/T[/T[/Sakquvupp qp,}o6 xm>rjEmhJhfO&cdT-^bZ3Za`7W`h:T_r;S_|s(>r(>r(>r(hs|zp lh)c3^; YBTGOMJS#FZ'Cb)Bl)Ax(@'?%>$="=!<~!;}!:|"9{"9{"9{"nyvic`#\.X7S> NDIJEQAX?a =k N;V9_8j7v6554320////||m^QJGE)A3=;:B 6J 4S2\1g0s 0 / . , +*) ( ' ' ' ugYL?864(22/:-C+M)W(b'n&|%#" {m_RE9.% #"$ .8BMXetrdWJ>1'  %1<IVewljƝƳugZMA4) *6DSdwً٠ظxj\OB6* !/>Nau{l^QD6+   &6H\q~o`SE7+  .BVj}   "0>KXdox   -;HUaku|   )8EQ]hqy  %3@MYdmu|  !.;HT_iqx~(5COZdltz  " . < I U_hpv}&'% %5DP Z!c"k#r#y$$%%%&&&&'''''&&&"'.//) #'0)>+J,U-^.f.m/t/z//00001111000///&.6<=8003*484E5O6X6`7g7n7u7{ 8 8 8 8 8 8 8 8 8 7 7 7 7 7 7 *4@FGD>;=%=3=? =I =S =[ =b =i =o=v=}==>>>=======<<0=HNQNGDF!F/D: CDCMBUB]BdBjBqBxBBBBBBB~B|B{B{BzAzAzA4DOUXVPL MM,K7 I@HIGQFXF_FeFlFsF{F}F|FzFyFwFuFtFsFrFrErErE9JU[]\WRSS(R4O=MELLKSJZ}Ja|IgzIoxIvwIuJtJ rJ pI!nI!mI"lI kIjIjIjIjI@OZ`ba]XXY&W1U: SBQI{OPxNVvM\ tMc"rMj"pMr#oM{$mM$kM%jM%hM&fM'dL'cL%cM#cM!cL cL cL ET^dffb]\]"\/Z8 ~X@zUFuSLrRR!oQX#lP_%jPf'hPn(gPw(eP)cP*bP*`P+^P+\P,\P*\P'\P%\P#\P#\P#JXbgjjgaa aa,_6 z]>uZDpXJlVO!hUU%eT[(cSb*aSj,_Ss-]S~.\S.ZS.XS/VS/US/TS-US*US(US&US&US&N\eknnlfe fe){d3vb<q`Bl]Hg[M cZS&_XX*\X_-YWg/XWp1VW{1TW1SW1QW1PW1NW1NW/NW,OW*OW)OV(OV(S`iorsqjjj|j&wi1rg9 le@gcFbaK^`Q%Y^V*V]]/S\d1Q[m3O[x3N[3L\2K\2J\1H\0H\/H[,I[+I[*I[)I[)Xdmrvwvoo{nwo#rn.mm7 hk>cjD^hJYfO#UdT)PcZ-Mbb1Kak2Iav2Hb1Gb0Fb/Eb.Db-Cb,Ca*Ca)C`)C`(C`(\iqvz|{u}tutqtmt+hs5cr< ^pBYoHUmM PkR%LjY*Hi`-Fij.Eiu.Di-Ci+Bj*Aj(@j'?i&>h&>g&>g%>f%>f%bmu{|yzpz kzgz'cz2^y: Yx@TvFPuKKsQ!GrW%Dr_'Bqi(Aqt'@r&?r$>r#=r!{h ={s<{;{:{9{8{8z6y5w4v4v4vnxrd[ WT(Q2M9H@ DF@M=T:]9g8r76543310///t~}m`RMK!H+D4@<=C 9J6R4[3e2q1~0 / . - , + * ) )){xiZMB><#9-653=1F/N-X,b+n*{('&$#"!   qcUH;0,+!)+'4%=#G"Q \hvwi\NA4)&0;EQ ] l ||n`SF9-" !+7CO^nrdVI<0$%1>L\pЄЙϯufYL>2&)7GYoxi[N@3'!1BUk|l^PB4' )<Pez  .;IVblt| +8FS^hqx  '4BOZdmu{  #0>JV`iqw}*8EQ[dlsy   $1?KV_hou{  *9FQZcjqw }  ! 1?KU^fmsy!',+$,!:#F$Q%Y&a&h'o'u({((()))))))))((((3994+'+&,5.A/K/T0\0c1j1p1v1|11112211111100%2=CD@936!6/6;7F7O7W7^7d7k7q8x 8 8 8 8 8 8 8 8 8 ~7 }7 }7 }7 }7 *<FLMJC= ??+>6=A =J =R =Y =_ =f =l =s =z===~=|={=y=w=v=u<u<t<t<3CMSTQKEFF'E2D< BEBMATAZAaAg}An|AvzA~yAwAuAtArApAoAmAmAl@l@l@:ISXYXRLKM#K/J9 HAGH}FOzEVxE\wEcuEjsEqrEzpEoEmEkEiEhEfEeEeDeDeDeD@NX]^]XRPR Q,O6 }M>yKEvJLsIRqIXoH_mHfkHmjHvhHfHeIcHaH_H ^H^H]H]H]H]HES\acb^XU VV)}T3xR; tPBpOHlMNiLTgL[eLbdLi bLr!`L|"_L"]L#[L#YL$XK$VK#VK!VKWKWKWKJW`dgfc]ZZ~['yY1tW9 oU@jSFfRKcPQ`PW!^O^#\Of$ZOo%YOy&WO&UO'TO'RO'PO'OO'PO$PO"PN!PN PN N[chkkha_~_y_$u^.p\7 kZ>fYDaWI]UNZTT"WS[%USc'SSl)QSv)PS)NS)MS)KS)JS)IS(IS&IS$JR#JR"JR"S_glnolfcycud pc,kb5f`< b^B]]GY[MUZR#QXY&OX`)LWi*KWs+IX*HX*GX)FX(DX(CX'CX%CW$DW#DV#DV#Wcjpssqk{hth ohkh)gg2bf: ]e@YcFTaKP`P!L_W%I^^(G^g)E^r)D^~(C^'B^&A_%@_$?_#>^">]">\">\">\"\gotwxwqxonninen%an/]m7Yk>TjDPhIKgOGfU"De]$Bef%Aeq%@e}$?f">f!=f mewR;wZ9vd8vo7w{6w5w5w4v3v1u0s/r/q/qmv~}naSNL!I,F4B;>B ;I8P6Y4c3n2z10 / . - ,} +| *{)z)zs}zi\OD A?%=.966>3E1M /V .` -l ,x+)('%%$## # {teVI<420&./,8*@(I&R%]#h"u!{m_PC7+# !$-7@JUan} tfXJ<0%   )4>JVdsxj]OB5( &1<HVfx}n`SE8,   "-9FUg{ɐȦǿrcUH:." '4CTh~ߔߪufXJ</# ->Rgyj[M>0$ %7Md|+9HT^hqx~   '6DP[emt{  $2?LWaiqw} -;GR\elsy~'5BMW`houz  .<HR[cjqv|  '5BMV^flrx}  .< G Q Yahntz$(&'5BLT\ciou | !!!!""""!!'1550&""%0&='G(P)W)^)e)k*q*w*~***+++++++***"1;@@;4+ -/+070B1K1R1Y1`1f1l1s2z222222}2{2y2x1x1w1w1*:DHIE?668&727=7E7M7T7[7a7g7n7u}7} |8 z8 y8 w8 v8 t7 r7 q7 o7 o7 o6 o6 3BKOPMG@=?">.>8=A jJDgHJdHPbGV`G]^Ge]Gm[GwZGXGVGUGSGQGQGQGQFQFQFIV]acb^YT|SwT!rS,nR4iP; eNAaMG]LM[KSYKZWKaUKjTKtRKQK OK MK LK JK JKJJKJKJKJNZaeggc]~YwXrXnX)iW2dU9 `T?\REXQJUPPROWPO^ NOg!MOq"KO|"JO"HO"GO!FO!DO!DODNDNENENR]dikkhbz^r] m]i]&d\/`[7 \Y=WXCTVHPUNMTTJT\!HTe"FTo#ETz"DT"CT!AU @U ?U>T>S>S>R>RWahmppnhwdmbgbdb#`b-[a5W`; S^AO]GK\LHZSEZZ CZc!AZm!@Zy ?Z>[=[<[:[9Z9Y8X8X8X\flqtusnukghah]hZh)Vg2Rf9 Ne?JdEFcKCbQ@aY>abjP;jX9ja8jk7jw6j5j4j3j2j1h0g/f.e.efov{||ozaxTuOuLv!Jv+Fu3Ct:?t@ }.;}68}=5|D3|L 1|U /|^ .|i -|u ,|+{){({'z&y%x$v #u #u r{vfXK=754'10/8-@+I)Q'[&f%s$"!zqaSF8,(&$(#1!: CLVbn|xj[L?3'&09C N Zgu~pbTF8,  $.8CO]k|ugYK=0$",6BO_pzk]OA4' (3?N`sˆž~o`RD6) #/<M`vڍ٤ػrcUG8+*9LaxvgXI:,$6J`w  )8EQ[emtz   %4AMXaiqw} !/<IS]emsy~*8DOYaiouz $2?JT]dkqv{+9DOX_flrw|%2?IRZagmsx~ *8CMU\cintz  !$" #1=GOW^djpv}%.21+! +7B K R!Y!_!e!l"r"y"#####$$}$|${${#{#!/8<<70%$'&(2)=)F*N*U*[*a*g+n+t+|+~,|,{,y,x,v,t,s+r+r+q**9BEEA:2-0!0-181A1I1P1V~1\}1b{1iz1px2xw2u2s2r2p2o2m2k2j1i1i1i12@HLLIC<5 77)737<|7Dz7Kx6Rv6Xt6^s6eq6lp7t n7} l7 k7 i7 g7 f7 d7 b7 a6 a6 a6 a6 9FNQRPJC==>%|=/x<8u<@ r;G p;M n;T l;Z j;` i;h g;p f;y d; b;a;_;];[;Z;Z;Y:Y:Y:?LSVWUPJCC{D"vC,rB5nA< k@C h?I f?Od?Vb?\a?d_?l^?v\?[?Y?W?U?T?S?S>S>S=S=DPW[\ZUPJzHuIqH)lG2hE9 dD@ aCF_CL\BR[BYYB`XBiVCrUC}SCQCPCNCLBLBLBLALALAIT[_`_[U}OuM pMlM&gL/cK6_I= [HBXGHVFNTFURF]PFeOFoMGzLGJGIGGGEGEFEFEEEEFENX^cdc`ZyUpRkRgR$bQ-^P4ZN: VM@SLFPKLMKRKJZJJbHKlGKxEKDKBKAK?K?K?J?J?I?IR\bfhhe_vZkWeWaW ^V*ZV2VT8 RS>NRDKQJHPPEPXCP`BPj@Pv?P>Q=QV_^M;]U9]^8]h7^t6^5^4^3^2^1]/\.Z.Z.Y`iotvwvzrooalTiNhLiIi)Fh1Bg8?g> x9x7x5x(3x01x8.w?,wG+wP)wY(wd&wp%w}$w"w!vvusrqqrzscUH:/ ,* (*'2%:#C!L V`mz~}|{zzy|m^PB5(  )2;EOZg u ufXI;/#  )2<GS`n}{m^PA4( (2=IVeurdUG9,   &0<IXhzwhZK=0# "-:HYl{l]O@2% )6GZpӆҜҳo`RC4'  %3F[rsdUF7(  0E[r  '5BMXajqw}#1>JT^fnty~,9EPZbjpu{ '4@KV^elqv{"/;GPY`gmrw| (6AKT[bhmsx}"/;ENV]cinsy '3?HPW^diou{" -8B K R Y _ e j p w ~~~#,/,'&2=EMTZ`flsz~}{yxvvuu!.6983+!! -!8"A"I#P#V#\#b~#h}$o{$vz$x$w%u%t%r%p%n%m%l%l$l$*7?BA=6.% ')(*3*<~*D|*Kz+Ry+Xw+^u+dt+kr+rq+{o,n,l,k,i,g,e,d,c+c+c+2?FIIE?8//0$|0.y17v1@t1Gr1Mp1So1Ym1`k1gj1oh1wg1e2d2b2`2^2]2\1[1[0[09EKNOLF@8~6z7 u7*r63o6;l6Bj6Ih5Of5Ue5\c5cb6k`6t _6~ ]6 [6 Z6 X6 V6 U6 T5 T5 T5 T4 ?JPTTQLF?x;t<o<'k<0h;7e:>b:E `:K ^9Q ]9X [:_ Z:g X:p W:{ U: T;R;P:O:M:M9M9M8M8DNUXYWQL|FsA nAjB$fA-b@4^?;[>A Y>G W=M U=TT=[R>dQ>mO>xN>L>K>I>G>F>F=F=F<G<IRX\][WQyLnGhFdG!`F*\E1YD8UC> RBC PBJNAQMAXKBaJBjHBuGBECDCBC@B?B?B?A@@@@MV\`a`\WuRiLcK_K[K'XJ/TI5PH; MGA KGGHFNFFUDF^CFhAGs@G?G=GL\=Lf;Lq:L~9M8M7M5M4M3L3K3J3JU^dhjig{ap^cZXV TVQV!NV*JU1GT7DT= @SD=RJ;RR9RZ7Rd6Rp5S|4S3S2S1S0S /R.P.P-OZbhlonlyhneaaS]M\K\H\'E\.B[5>Z<;ZB 8YI 6YP4YY3Yc2Zo1Z| 0Z /Z .Z -Z ,Z *X )W (V(U_gmqttrwnll^iPeFc CcAc#>c+;b28b95a@3aG 1aO /aX .ab -bn ,b{+b)b(a'a&a%_$] #\ #\ dlrwyzyvvis[pMm?k:j8j6j'4j/1j6/j=-jE+jM)jV(j`'jl&jy$j#i"i ihgedcjrx}t}ezWxIv;t1r .r,r!*s)(s2's9%sA#sJ"sS s^sjrwrrqqpnmllqx~p`RD~6|*{"{ {{#|+|4|<|E|O|Z|f|s{ { z yxw u u txyj[L?1% # + 4 >HS`m|~}rcTE8+#,6@LXfuxj[L=0$ $,7BO]m~~o`RC5(!+6BQbtteVH9+ (4AReyxiZK<. $1ATi~͕̬|m^O@0#-@UlqaRC3$ *?Vn$2>JU_gntz -:FQ[cjpv{ )6BMW_flrw|#1=HRZbhmsx}+8CMU\cinsx} &2=GPW^dinty~+7AJRX_djotz  $/:DLSY_ejou|(3=FMTZ_ekqx~}{ z y x x "*+(#  " - 7@HOU[agm~t}|{zxvusqpooo!-464/' (2;CJ}P{Vz\xbwiuqsyrpomljhgffe)6<>=93* !#}"-{#7x#?v#Ft$Ls$Rq$Xo$_n$el$mk%ui%h%f&d&c&a&_&^&]&]%]%2=CFEA;4+~'y(v))s*2p*:n*Bl*Hj*Nh*Tg+[e+ad+ib+ra,|_,^,\,Z,Y,W,V,U+U+U*9CILKHB<4w. s/o0%k0.h06f0=d0Db0J`0P_0W]0^\0fZ0oY1yW1V1T1R1Q1O1N0N0N/N/?HNQQNHC{<r5l5i6!e6*a52_59\5@Z4FX4LW4SU4ZT5bS5kQ5v P5 N6 L6 K6 I5 H5 G5 G4 G4 G3 DLRUVSNIxCm;g:c;_;'[:/X96V9<S8BQ8H P8O N8W M9_ K9h J9s H: G: E: C: B: @9 @9 @8 @8 A7 HQVYZXSNuIiBa?]@Z@$V?,S>3O=9M=? K=E I=L G=T F=\D=eC>pA>|@>>><>;>:>9>9=:<:<LTZ]^]Y|SqNeH\E WETE!QE)MD0JC6GB< EBC CBI ABQ?BY=Bc vH vSv^vlvzuutrqponw~vgWI;.! &.7BMYfu~}{zyxx}o`QB4' '/:EQ_n~vgXI:-  '0;HVev{l]O?1$  &0=K[lqbSD5' "-;M`tufWH9* +;MbxШzk[L<- );Pf}~n_P@0 %:Rj .;GR\dkqv{*7CNX`gmsx| %3?IS[bintx} .:DNV^djoty~ (4>HQY_ejoty".9BKSZ`ejpuz(3<EMTZ`ejpu{!,6?GNTZ`ekpw~~}||  %/9AHOU[`flrz}|zxwutsrr!'(%)3;CIPV}[| az hx ow vu s r p o m k jiih ,131+$  "-}5{=yDwKuQsWr]pcokmsl|jhgecba`__*4:<:5/&~zw(t1r9p@nGlMjSiYg`fgdpcya`^\[ Y X W WW2;ACB>80(w s!o"$l"-j#5h#<f$Cd$Ib$Oa$U_$\]%d\%l[%vY&W&V&T&S&Q&P&O&O%O%9AGIHE?9{1q(l(h) e))b)1`*8^*?\*EZ*KY*RW*YV+`T+iS+sQ+~P,N,L,K,I,H+H+H*H*>FLNNKE@w9l1e.a/^/%[/-X/4V/;T/AR/GQ/NO/UN/]M0fK0pJ0|H1G1E1C1A0A0A/A/A.BKPRSPK~Ft?i8`4 [4X5"U4*R40O37M3=K3CJ3JH3RG4ZE4cD4mB5yA5 ?5 =5 <5 :5 :5 :4 :3 :3 GOTWWUP{KpFe?[:V9R:O9'L9-I84F7:E8@C8GA8O @8W >9` =9k ;9w 9: 8: 7: 5: 4: 39 38 48 47 KSX[[ZVyPnLaFV@P>M?J?$G>+D>1A=7?=>==E ;=L 9=U 7>^ 6>i 5>u 3? 2? 1? 0? .?.> -= -< .< OW\_`^[vVkQ_MSGJD GDDD!AD(>D/J;J&9J-6J34J:1IA0II.JQ-J[,Jf*Ks)K(K'K&K$K#J"H"G"F X_dhihfsbh_\\OWAR9Q7Q5Q#3Q*0Q1.Q8,P?*PG)QP'QZ&Qe%Qq#R"R!R QQPONM]dimnn~mqiggYcL_=[2X /X-X+X')X.'X5%X=$XE"XN!XXXcYpY~XXXWVUTSbiortt}sqpcmVjHf:c-`%_#_"_" _*`1`9`B`K`U```m`{`__ ^ ][ZZhouxz{|znw_tQqDn5l(jh hhh$h,h4h=hG hQ h\ hihwggfedcbaov{xj}ZzLx>v0t#sr q qqq&q/q8qBqLqXqdpspoonljiiv}sdTF7~*}|{{{{{!{){1{;zG{R{_znz~yxwutsr~zl]N?1$  ")3?KXgx}}sdUF6) !*5BO^oxiZK<-  *6DTex~o_PA1# )7GYlsdTE5' %4H^twhXI8) #4J`xّبֽ{k\M<, "5Ld|+8DOX`gmsx} '4@JT\cioty~"/;EOW_ekpuz*6@JRZ`fkpu{ $0:DMT[afkqv{*5>FNU[afkpv| $.8@HOU[`fkqw~(1:BIOU[`fkry}|zyyww !+4<CJPU[ag}m{uz}xvtrqpnmll $%!%.6~>|D{JyPxVv\tbriqqoymljhgedcbb!*/0-(  }z(w1t 8r ?q Eo Km Ql Wj ^h eg me wcb`^][ZYYY)27972+#x tp"m+k3i:gAeGdMbS`Z_a]j\sZ~YWVTRRQQP1:?@?:4-{$qlhe'c/a6_=]C\IZPXVW^UgTqR|Q O N L K J I I I7?DFEA<5v.l%d!a!^"#[#+Y#2W#9U#?T$FR$LQ$SO%[N%dL%nK&yI&H&F&D&C&B&A&A%A$=DIKKHB|=s5h._( Z(W(T)'R)/P)5N)<L)BK)HI)PH*XF*aE+kC+vB+@,>,=,;+:+:+:*:)AINPOMHzCo=e5Y/T-Q.N.$K.+I.1G.8E.>C.EB.M@/U?/^=/h<0t:090705040303/3/4.EMRTTRNxHmCa<V6N3K3H3!E3(B3.?24>2;<3B;3J93R84[64f55r352515/5.5-5-4-3-2JQVXXWSuNjI^CS=I9 E8B9?8%<8,:8288868@48G39P19Y09d/:p.:~,:+;*:(:':'9'8'7NUZ\][XsSgO\JQED?>><>9>"7>)4>02>60>>/>E->N,?X+?b)@o(@|'@&@$@#@"@!>!=!<RY^aa`}^qXfU[ROMAG8E 5D3E 1E'/E.-E4+E<)ED'EL&EV%Fa$Fm"F{!F FFFEDCBW^cfff|dp_e]ZYMT?O2K .K,K*K$(L+&L2$L:#LB!LJ LTL_MlMzMMLLKJIH\chkll{jofddW`I\;W.T&R$R"R S(S/S7S?SHSRS]SiSwSSS R QPONahmprrzqnnakSgEc7`*]Z ZZZ#Z+Z3Z;ZEZO [Z [f ZtZZYYWWVUgnsvxxzxkt]qOnAk3h&fdc c c c&c.c7c@cKcVcbbpbba`_]\\ntz}v}gzWwIu;s-q ommlll!l)l1l;lFlQl^klk{jihgfddu|~paQ~C|4{'yxwww vvv#v+v5v@uLuYugtvtsrqonn}xiZK;. $-8ER`q~}|zyxpaRB3& $.;IXh{vgWH8* $/>M^q{l\M=.#0ARezpaQA1# !0DXnueVF5%.D]vҍңѸyiZJ9) 0G_x (5@KT\cjouz~$0<FPX_fkquz,6AKS[aglqv{ &2<ENU\bglqw| ,6?HPV\bglqw}&0:BJPV\aflqw~ !*3<CJPV[aflry~~%-6=DJPV[agmt|}|zxvutssr'/7>EK~P|V{[yaxhvotxrpnmkjihgf!"  !~*{1y9w?uEsKqQpWn]mckkitg~edb`_^]\\ (,-*$|wt$q,n3l:j@iFgLeRdXb_`g_p]{[ZXVUT S S R (0564.' {s nj g &d .b 5` ;_ A]H\NZTX\WdUnTyRPOMLKJJJ08<=<71*v"me a^!\)Z0X7V=UDSJQQPXNaMkKvJHGEDCBBB6>BDB>9{2r+h#^ZWT%R-P3N9M@KFJMHUG^EhD sB A!?!>!%e<%q;&~9&8&6&4&3&3&3%3$@GKMLJEv@l:a3U,M' I'F'D(%A(,?(2=(8<(@;)G:)P8*Y7*c5+o3+|2+1+/+-+,+,*-*-)DKPRQO~KtFi@^:R3H.C-@-=-":-(8,/6-55-=4.D3.M1/V0/a.0m-0z,0*1)1'0&0&/&/'.HOTVVT|PrKgF[@P;D5<2937352&22,133/3:.3B,4K+4T*5_(5k'5x&6$6#6"6 6 5 3 3MSXZZY{UpPdLZHNCB=79 3818/9$-9*+91)98(9@&:I%:R$:]";i!;w ;;;;;:98QW\^_^z[nVcSXOMK@E2@-?+?)?!'?(%?/#@6"@> @G@Q@[AhAuAAAA@?>=V\acdcyam]bZXWKR=M0H&E #E!F F%F,F4F<GEGNGYGeGsGGG F F EDC[afhiixgldbbU^GY9U,QMMMM!M)M0M8MBNL NW Nc NqNNMMLKJJ`fknooxnlk_hQdC`5](YVU U U U% U-U5U>UIUTU`UmU|UTSRQQPflqtvvwuirZnLk>h0e#b` ^^^^!^)^1^:^E^P]\]j]y\\[ZYWWmsx{}}s{dxUuGr8o*mkihh hgg$g,g5g@gKfXfeeueddba`_tz|n^~O{@y1w$ut ssrrrqq&q.q:pFpRp`pponmlkih|vgWH8*~}}}}| ||| |'|2{?{L{Z{jz{yxwvut|n^O?0" (5DRbutdUE5& )8GXjyiZJ:+  *:L_s}n^N>.+>Rg~rcSC2! +BYp͇͞ʹvgWG6%*B]x%1<GPY`flqv{!-7BLT\bhmrw|(2=GOW]chmrx} ".7AJQX^chmsx~(2;CKRX]chmrx ",5=ELRW\bgmsy&/7>EKQV\agmt|~}{zyyy !)19?EKQV\a}h|ozwxvtrqonmmm $+3}:{@zFxKvQuVs\qcpjnrl|jigedcbaa |x&u-s4q;oAmFkLjQhWf^efcnax_^\ZYXWVV&**& }w rn k(h/f5d;cAaG_M^S\ZZaXkWuUSRPONMLL'.231+$vn hda"^)\0Z6Y<WBUHTORVP^O gM rL ~J H G E D C C C .6:;94.z'qh_ [ X U $S +Q1O7N>LDKKISG[FeDpC|A?><;;;;5<@A?;6w/m(c ZS OM K'I-G3E:D@BHAO?X>b<m;z97643333:AEFEB~<u7k/`)U!L HFC#A)?0=6<=;D9M8V6`5 k3 x2!0!/!- + , ,,?EIKJG|Br=h7]0R)G"A!>!M9B36.1,/,-- +-')--'.4&.<%.E$/O"/Y!0e 0s111000/.LRVWXVxSlNbJWELA@;36+3 (3'3%3$#3+!42 4:4C5M5X5c6q66665543PVZ\\[wXkTaQVMKI?C1>%: "9 99":):0:8;A;K;U;bAH AS B_ BmB|BAAA@?>Y_dfggueia`_S[EV7R*NJG G H H# H*H2H;HEHPI\IjIyIHGGFED_eilmmulii]fOaA]3Z%VS PPPPP'P/P8PBPNPYPgPvPONMLKKekort~tusfoXlJhM\n~}}|qbRB2# #1BRdzvgWG6' #4FXm{l\K:*  %8K`wp`P?.'<RjȂșȱteUD2"&@[s!-8CMU]chnsw})3>HPX^dinsx~ $/9CKRY_dioty*3<EMSY_dintz$.6?FMSY^chnt{ (18@GMRX]bhnu}"+3:@FLQW\bhow}{ywvttss %-4;@F~L|Q{Wy\wcvjtrr{pnmkihggg    }'z.x5v;tArFqLoQmWl]jehmfwdba_]\\[[{vs"o)m/k6i<gAeGdLbR`Y^`]i[sY~WVTSQQQP$''# xq lhe$b*`0^6]<[BYHWNVUT\ReQoOzMKJHHGFF&-00-(!zric _[X%V+T1S7Q=OCNILPJXHaGlExCA@?=<<<-47861+v$md[ UROM&K,I2G8F?D EB MA U? _= j; v: 8 6 5 3 2 3 3 4:>><8}3s,i%_VMI F D!A'@.>4<:;B9I7R6\4g3t1/.,**+,9?CDB?z:q4g-\&RHA >;9$7*60473>1G0P/Z-e,r*(&%##$$>CGHGEx@o:d4Z.O'D ; 642 0&.--4,<*D)M(X&c% p# !     BHKMLJwEm@b;X5L/A)6#0! -!+!(!#'!*&"1%"9##B"$K!$V %a%n&}&%%%%$$FLPQQNvKkF`AV<K6@14,*' &&$'"' !''(/(6)?)I*T*_+m+{+++***)JPTUUTuPiK_GUCJ??:35&/ ---.%.,.4/=/G/R0]0k1z 1 0 00/ / .NTXZZ~YtVhQ^NTKIG=B0<#74 344"4*515: 5D 5O 6[6h7w7666543SY]__}^s\gX^VTRHN:H-C?;: ; ; ;'GNU[`ejou{%/8@HOUZ_ejou|  )2:BHNTY^diov~$,4;BHMSX]cipx}|{z{ &.5<AGMRW]~c}j{ry{wusrponmm!(/}6|<zAxGwLuRsWr^penmlvjhgecbaa`  {x$u)r0p6n<lAkGiLgRfXd`bh`q^|\[YWVUUU {v qmj%g*e1c7a<_B^H\MZTX[VcUmSxQONLKJJJ"%$ { slgc_ ]&Z,X1W7U=SCRIPONWL_JiIuGECBA@@@$+..*%vm e^ YVS!P'N,M2K8I>HDFKDSB\@f>r=;987655,2553.{(r!i_WP LIG!E'C-A3?9>@<G:O8Y6c4p3}1/.-,++38;<:5y0o)e"[RI B @=;#9)7/6 54 <2 D0 L/ V- a+ n) |'%$ " !"# 8=AA@<w7m1c*Y$NE;6 410$.*,1+8)A(J&T%_#l!z<BEFEBu=k8a1V+K%A70 ,*( &'$.#5">!GR]jy@FIJJ~GtCi>_8U2I-?'4"*%" #+3;EP[h w    EJNON}LsHhC]?S:H4=03+(%! !!!!"("0#9#C#N$Y%g %u & %%%$$ #INRSS|QrNfI\ERAH==823&.( ''((&). )6 )@ *K*W+d+s,++**))MRVWX{VqSeO\LRIHE<@/:"50. . //$0,040>0I1U1b2q21100/.RWZ\]z\pZeV[SRPFL8F+A=85 667"7*727<7G7S7`8n8~876544W\`bczbp`e]\[PWBR4M'HD A> >>>?'?0?9>D>P>]?l?|>=<;;:\behiyipgeeYaK]=X/T!PLIHGGGG$G,F6FBFNF[FiFyFECBA@chlnpyppobkTgFc7_)[XUSRQ QPP!O)O3O>OKNXNfNvNMKIHGioruwzwlt]pNm?i1f"ca^]\[ [ZYY$Y.X:XFXTWcWsVUTRPOqvz|~u|fyWvGs8p)mk ihgffe ddcc(c4bAbOa^`o`^]\[Yy~}o_~O|?y/w!usrrqqppo onnn,m:mImXlij|ihgfevfVF5&} |{{|{{{zz zzz"y1yAyQybxuvusrq{m]M<, %7GYmrbRA0  ';MayvgWF4$ ,@Tk{k[K9( 0F^v~o`P>, 6Oh܀ܘܮ %0<EMU[afkqv|!+6@HOV\bglqv|'0:BJPV\afkqw~ !+3<CJPU[`ekqx%-5=DJOTY_ekry  (/6=CINSX^eks|}{yxvuuu")07=BH}M|RzXy^wfumswqpnljihgg }$z*x1v7t=sBqGoMnRlYj`hhfqd|ba_]\[ZZ zvr o%l+j2h7g=eBcHbM`T^[\cZlXwVUSQPONN }vq lhd!a&_,]2[8Z=XCVITORVQ^OgMsKIGFDDCC "!wnhb ^ZW"T'R,Q2O8M>LDJJHRFZDdBo@|?=;:999#)++'!{ri `YTPMJ"H(F-E3C9A??F=M;V9`7l6y531100/+0330+w%ne[SLGDA>#=);.947;5B3J1S/^.j,w+)'&&%$179973u-l&b WNE > :753$1*/0.7,>*G(P&[$g#u!7<??=}:s4i._(U!KA8 0 -+) ' %% +$ 3" ; D N Y ft   ;@CDB|@r:h5^/S)H#>4+$ ! (/8ALWdr      ?DGHG{Eq@f;\6R0G+<%2 )%,5?I U b pCHKLLyJpFeA[<P7F2;.1)'$ " * 3 =GS ` n!~ GMPQPxOoLdGZCP?F;;612%,&" "## $($1%;%E%Q%^&l'|'&%$##LQTUVxTnQcMYJPGFC;: :::":*:3:>9J9W:f:v:97655[`dfgwfmeccW_IZ;V-RMIFDC CCBB'B0B<AHAUAcAsA@>=<;afjlnwnnl`hReD`5\'YU RONM LLKK$J-J8JEIRI`IqIHGECBhmqsuxujr[nLj=f.c `][YXWV VUTT(T4SASNR]RmQQPMLJptx{|szdwTsEp5m'jh fdcbba` `_^"^.^;]I]X\i[{ZYXVTw|{l]|My- !6I]steTC2!%:OexiYH6%*AXp|m^N;)0Ib{֓֫",7AIQW]chmrx~'1;DKRX]bgmrx #+5>ELRW\aglry &.7?EKQV[afls{!)18?EJPUZ`fmu~~}| #+28>DINTY`g}o|xzxvtrqpoo%+2}8{=zCxHwNuSsZqapinrl}jhfdcbaa {xu&r,p2o8m=kBjHhNfTd[bc`l^w][YWVUTTzu qmi!g'd-c3a8_>^C\IZOXVV^TgRrPOMKIHHH xqkgb_\#Y'W-V3T8R>PDOJMQKYIbGmEzCA@>=== { rjc] XUQN#M(K-I3G8F?DEBM@U=^;j:w8653322"')($wne\UP KHDB#@(?-=3;:9A7H5Q3[1f/t.-+**))).10-}(t!jaW OGC >;86$5)3/15/=-D+N)X'd&q$"!05774{0r*h$^TJA:5 2/-+%)+'1%9#A!KUbo~5:<<;z7p1f+\&RG>4 ,(%#! &-5>HS_m}     9>AA@x=n8e2[,P'E!;2)    " * 2 ; F Q ^l{  =BEFEwCm>c9Y4O.D):$0'   ' /9CO\jyBGIJIvHmDb?X:N5D09,0('#  %-7AMZhxFKMONvMlIaEWAN=D9:511%,%  #+ 5 @ K X!f!v"!JORS~SuRkO`KWHNEEA;=-7 2,'& %&&!&)'2'=&I'V'd't('%$##OTVX}YuXkU`RWOOMDH6C)=83/. ---.'.0.;-G-T.b.r.-,*))TY\^}^t^k\`YXWMS?N1I#D? ;86 6555%6-595E4R4`5p54210/Z^bd}eudkcaaU]HX9S+OKFC@?? >=="=*=6=gloq}svshpYlJh;d,`]ZXUTSRR QPO"O.O;NINWMhMzMKJGEnsvy}zqxbuRqBn3j$geca`_^]\[ ZZY(Y5XDXSWdVvVUSQPv{~yj|ZyJw9t*qo mlkjiihgffee d.d=cMc^aq`_^][qbRA}0z ywvuuttssrrqqqq$p5pEoWojmkjihwhXG6%~~~}}}~ ~})}<}N}a|wzywv|n]M;*  1DWmrbRA/ 5Ja{vgWF3!%;Rjzk[K9&+D\vяѧ  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"$%&()*+-./02346789;<=>@ABDEFGIJKMNOPRSTUWXY[\]^`abcefgijklnopqstuwxyz|}~  !"#$%&'()*+,-./0123456789:;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~mft1!  !"#$%&'()**+,-./0123456789:;;<=>?@ABCDEFGHIJKLMNOPQRSTUVWXYZ[\]^_`abcdefghijklmnopqrstuvwxyz{|}~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~  !""#$$%&&'())*+,--./01223456789:;<=>?@BCDEFHIJLMOPRSUWXZ\^`bdfhjmoqtvy|~ozPMXэiJqѼËn? vCC[!6xqP?+ˠy=Yĝ¯ԎP3[݋C,Z mt)OG7}G> ʃDpНh<43Hg̦ڴkA.#]b2s)~Cak I04}6z] fs0M^*.͕gSN^uķoQ@2#`׋F 7G_ q)YhE$1=_k"Qk+3r7kYT]ky鲏vdUD3xz;Bt'5TnYfG"4UcBF*-ݢc9.ѫ~˴~mbĄT4 `df9'O_cP#@-Tz)q k̿wW=&$/;GTs紐s[E1eb'5Pap"GO!l&lN2 'i < ӿxia`gpzʲt_GAʊ[8NjKTnhzղ}qib^YURNKJLPV_j6dE2*b >d,ZT23*C^|/=O`pŽl\OE=5.)$"*7>t/X~Cm$W#* $@^}t 0@Qf}Ռӷ~yuroppsxJ8*! Frn7Z]J:7&d )K..Mlk  1F]vagzrib\WRMJHGGILS^o]',T|+QxAb= +Kno3JcMCWk~ɻcVLE>950,*('(,29JhFt#Jp,4\S4U{},C]}R.BVj~}zyz{B91*%"(Hr@k'.M-S{q"Fl8/Gba"7Lbv||tnjhggigkqx/! 2^I1]p'Rz58_V$>/ProcSet[/PDF/Text/ImageC]/Font<>/XObject<>>>/Parent 4 0 R/MediaBox[0.0 0.0 612.283 858.898]/TrimBox[8.50389 8.50389 603.779 850.394]>> endobj 6 0 obj <>/ProcSet[/PDF/Text/ImageC]/Font<>/XObject<>>>/Parent 4 0 R/MediaBox[0.0 0.0 612.283 858.898]/TrimBox[8.50389 8.50389 603.779 850.394]>> endobj 7 0 obj <>/ProcSet[/PDF/Text/ImageC]/Font<>/XObject<>>>/Parent 4 0 R/MediaBox[0.0 0.0 612.283 858.898]/TrimBox[8.50389 8.50389 603.779 850.394]>> endobj 8 0 obj <>/ProcSet[/PDF/Text/ImageC]/Font<>/XObject<>>>/Parent 4 0 R/MediaBox[0.0 0.0 612.283 858.898]/TrimBox[8.50389 8.50389 603.779 850.394]>> endobj 9 0 obj <>/ProcSet[/PDF/Text/ImageC]/Font<>/XObject<>>>/Parent 4 0 R/MediaBox[0.0 0.0 612.283 858.898]/TrimBox[8.50389 8.50389 603.779 850.394]>> endobj 10 0 obj <>/ProcSet[/PDF/Text/ImageC]/Font<>/XObject<>>>/Parent 4 0 R/MediaBox[0.0 0.0 612.283 858.898]/TrimBox[8.50389 8.50389 603.779 850.394]>> endobj 11 0 obj <>/ProcSet[/PDF/Text/ImageC]/Font<>/XObject<>>>/Parent 4 0 R/MediaBox[0.0 0.0 612.283 858.898]/TrimBox[8.50389 8.50389 603.779 850.394]>> endobj 17 0 obj <>stream HVn7}T4omi U!(hlbKr}23"ɻn\p'á!*l!Gu#_l>mLp Zz|`_)i# M!F>3+yPba7°n4<3l'ǤhJ2z&=TռU9pg*l2Jo7 C⡹wsgeig6DVᡜ2gQ{_ !|as(L ; X)7a@⣬Rʅ"F:p*:Dؿ=XM=x*͜zp*zMT,1fBAAod\D[k[lO~Ϯ_>|?}b\F"& j7{_WG?k6[ާw~ HbI;v=K'񷋯,ꅳ)#U _>r(D vU7_]cpB  X堐%*ǦJ$T׆Gl^"M!mҩ,յtpL olH'0cG>Mk;ˑGUNp)DtĽHu"YK$4iDWt7bBAt֡20Ĥn&hyA˷3@l`] ? endstream endobj 19 0 obj <> endobj 27 0 obj <>/Type/XObject/Width 991/BitsPerComponent 8/Length 2078394>>stream HLmwj{KN@@ؑW[MeIc֖f$9yi<{W'S /Gt}]ҡh2F-tD}]óUSlOW=#.t䃠 +h8W#rB\񀸹^zCsT#_ L<>g믙R]EqMAu\.Dk=W \ F_[\/6y;K%/jxZ$s(D$3IE7>ц{hUloo$&+]qm'3ͅ<}E3 㢝=oテ{#[oFj$s̥:Li3׈s:D;W< a]J?}FmER3n42`z4ӬhrMu;E6hhTMR; J4h,D.EcE|% mlTR9QܰMTmD j@mpHK7u_s'8{ wS$ dRP$$cIM&5Xckpǡ}u?t]hoS_KeWZv^ywl)\l~e]f,t3V#K< Vsyƾk'zUh¾ "uu!t5N)gCG-twĹ"Nibg%3q71r#0{3x{#6u|gH`ٴNp~Z"e(p ^';gnq>ghb8w_3JdȨX]ߏ4*//1mjG8#~4ٞ^~Cbge·y8骧4KتWz_+xҒ:h{Dhi]+xUe#++s?sOwOg70vx㵲r'%XDf엫7~AMlR!RɠC:X!zghmC'l[u2 '# 5m6^?:kO&8ו'EVM)G拜U'y:3`a5O>j@ 5M6jԢӢM)UHԀ'u+==ȭ u|F=34*G8 ,2Yn)n:T񉯯FG?%=tD.l#co4G} N=psj@|n NwC[ 3hG~lؙjʺ6Kە&k&qӤ}]N4n41bЌ@ƀd0i~o$!1Ot#}8뀐}j p!tgKH uř #-?ckT;3/sg7k::>(b{<,3'z\4 >w;WYEEIfJq eqKCq~zW &xCU);ɗ,.e̯{ԯDg:Zt#Y$lvt]:\9JíGe^1V{[+G=Wdd-Bc/6bJXŚ4PV[f+cjVT&&4f=]䑮ڙ%*/xz~EK<<9=gYO28̗  htT>;K5kLǙMXFCj%G?$>es/#:鰀yQslHLs EH:l+u<\KER[TN\ Y!q>(DVs .L&nr0+3n4x EPn"Eؘ oTafxPO)Q+4G916QSDzmsŃ-skiO,D5swFT{-.}vS %D^;**nA'gRs e#p]z=6HLQSx) x lZm)sWdL3Wg&1o' _3_?&Ʌc?&'f;!\/%32XqH\\._sR0J\G،qiX?P<ln7;dTj|Hq6U}J-U&IK=cki)RMʲiuA.ȷ:)l}ž 9iojɷ xNc;{)fE7w]5%|9GNU3Η]x+Q{h(zpR\r>3ΡzFs 1'gcOQ*Yv{:gRu"=8(W|L_DTsS0svpj2.|`*1&7 >Ǘr5+L*MRI8X:Sd <|XӾ"O0zãEDE{Bb*c޷mۤ=#o=r]Pr gaxZ&K5ySn޳d'} ǔkqk*jƷ~{kk w|̯K<[@gw{|ΰw _ 596C@4va#G@zN9r2e 翁o|C׀?~~bNi =kO'nY2&T%=[=ΫT¯v3Zw铖n-a>8? Bh+o(ӱ^1U.UL:8֣@َ1NDfmq ȴgTx c푭7ɗaWdԑFi2iyZ{?E[Z*n8$uVuqc"G*[VE-QHHiqIZ\rK~߀Rz; ̝`GiYDMa>~TѶINњwA|éT6:wߡ[׈-ostOn3z̋#cŹJ^^[kgk֫){ Xa?:S~ e54* 'y:j)q: ]Sqf<: -C}HZ~}+[J{˄OX&P4\|r+)<mb2$g 99]9Y ?9U2/rFy2T}[מuQ6_q\'<￾nF*r 2[䖫||;zMn9cuLB9߬&/93CI[3Lzԏ\5ER)mB{+TLAلtLSOQ50"4VE^ǣ\y\%wZ,2t}^4>Z/ {I/3>[OV ~5(Yշ>@K:v> Osç`?m_\ {-/V~ X s:=S4p,Ҝ&E^;#}'q,f3]Z!ol-x0۽~69&eQf`MP*"ߐel]MVkkՉඏ|RJ-T^̃S%< 4}^7oƧR\2fM+402/ \!FGkqu°&PoG{xz>+Qԑ- M}괲K\ S/|3gxP/D0'W? z\%^âq܋g,0Fc=e=Ud'>2yJorJsMeVRfs81{nOhLLS|,<?Ձ!=c)S& Fz]I">$}mI4@IȢӡJOIѐJ]u8!sk` *MW^EA۞CQ^Ru hZr?ݦԡVWKnR~rڨC]tEc#|y Y^X 37r+x1Z*4_٣|'.*;O9@\Yr!e%s r%ow"njh(jG/~ [3Q>`2P8]6g0yL#>zq)۶g{#Ѓw*8[mW~Qw"Wb{c8\pnQN=tuyC/J<ک^[Zm駠Y0<y s)_]ʊגyMk$N-~zzFOwRϦ*%VRtEk #r .z麏 [+JX$܊I5ɛko\W{~֥BYmiAP\Yu%1l˗q-Kr̗s %9%qq(dz1r chZ5 [T^]@8gfs.Uk4QhaKd YD5a9w^tp8CpAbk Cm skyl2 k+yQq)Qgߘ+ M̉(ٌ1~$9W~]vaHk}Xs *i9~sy\[D1nC@UhDK] q^x&Q ?"^eKrl*1|Mא ̠UQ|xEp&DC^?yמ?S/y W)< Ep]l+BwK/f<+v1Z^cS 5r[  vMi?`8@1bڝRCfL@.0sRkY5ȫ=tnE:6ؓ ɋ8Ht>B:h]GA='97SݫI|褞Zw'uzݘԵKPɬMoᙵzPn#`vq+a|-(CdRNs٬el<uO"_}ɍ~}\̇~߈:H9V{SpIt%.)DG>培=% 29s&"#7ـ1pILYGSp>ڌWt rR&̆vUB~;x)u{c{:s(eũ7Qʍ㕿0xC"f,ZyڂKmزW}ƸyhOf9I/ogZIzJ,_kep@^)kAm<3~4 0zO8+C*VߴעQ:iNDб_& _1i 4QwM㻉k|;nOjM6'Ӛq+{;$eG];k"e_kx'soourq)K7}alEYf'^Jܨ4x29kZmmVv2ݴgOj;4k塗Xgc>3 _(#v܋#QT}kKY8#_gnᳺʋOmt[z/7qザ86_y79hs{v'l)GҜ~様rAW__O7"?u 鰓V2L6mkȁJ3vCDO!$/۳z2/uw<?lb2q>Λ9Ώ>KnF3OlUrRPV!1M*LkZfPϬOki4u;h"+GTDvxo- x2*8K?Z}Gktϥ{&aN4qu g]V\6Wg5'W^H9|$ #+ߊΉ9!%?n^ogG[ 欝ij)w0Da}RoΟ&?Li:9ZTা&A}?s3?}M}3l[/g]i#uԯ{֔5lx_yGhKʹQ/WH݇?̒W`CoZE:#HPcy# E໘NQSSQ馞Q c)c L,T UEK22BUY3DK扦(μ >.:r.iϢ q^ͼUvky2K]eOֹ |b+,{rܯՄod-sG>t uEɶ]hls~Z[#͍9 tWgs.7eIn뚬"ϸwKZbM6Vv;c*xK&0XO49C#*GfIzMR,'c« zWK RjAjラgoAӟVö$6B_}ӛ|B~h0q>Id+Sp$#;ڜ6ETMekfS$$$<7'q6F Ę$@@ 6IHso nj}砎e֬PKF=ϳؙ3+LIl ázFmzD=?58?T/٣iܸ*v\ 6rʘTb\pzp`-ֿKuYw-cc?֤WO{(*M~֖*0Aro\;j#?MhͳlU <֌u'B7I{3^ QQ|$2pflz{p6/ٷ%ƆЙVIW%k_C^RӾSi$@|TzP}*)L{6A? !`< ^q/+Җ]џ%_{+̯{m=ož2¾.TD..40)~A#%x %{.K_XST~~ 8Fkc|?99ρW1s J? ϭS j/̺;зJٟY/<ⷙ{^[q[%WF^oIe[O\|\הox V:]lpbO{K'ҹ㿕J >wKy&r][}dV-M'K[ok!zXzMЉR4TyYq,x[ J`Xb 4x !ۄ ߎ:ϟkN^SuQNx]W|fu3/b˵]Εx~;g2Ҿgaw{tϞ%i8hHW TmQOHYghS/'jGE:X"o+yZz(~}(YУ s n1Nu<kIIy V48K^>% "`1kU| ,sS)@/>|&& *%PVaYR?"K]~xFzm鿸q]M#Y ~24CH7df ͒lWٖن?[e'bνUv|OʊbN{^~r_=3җ /OJI\-zޡ98Ƣ̿8/+qP F#!5mM*%!ω>@@/-+/Zsy~3_kaq'\$Wݤсiֈg fSjH4)2׉Ϝ7$mqΤ)r^SsȦ5[k=)q+sXעB+'Z%/>Ӳ#=}ǒHBFLb ]([_iSu5'r8)Z,ۅmہfQ;,k ]9˜[Y+t::r/ԬXl6ғ_"Kl\*ީfI/2MZZ|CGo6x)k(OVzYȽ-LE9VN;a7S :8D o{{{_̅3nS7o†%'>M{eE`>wyXԾR=CgrlG~vУe3/*TaU!Q`R<]77W ~EyB̉_N/#{Gb_ {_ysO 頪-UE#X]s{:+(P3;f2s 9?Wn#S=^u mYo[ ,C{fRj9)0Bkk cVXkl]ø1F~#^$E[,{-Q]_$3ʨhN\sWk+.Yq-@ufszɬ0?k~uDa>K_'+=yy{s҄k3!eq>0z]7|Hk]~oÛ.+FW.O'gm ;n)Oj#YhߧèGRSyгۡ̚ІYZ|~~nsG)?27P4x)?fĸQ;Azq 9ĢtuV0`5mD<θ]oHY4%)=o81hkkǨ{y}Vd|\n.a=㗌,3^=mMӌEN([{Y`9#TzXM>@פqogB?\}7/D;mh^6c+a+>"q7i]a/N5{JԜԊK:T[T] fn,ioy+Y[]魥<|CyxFǰC DZ,}|}XƑd% (3-AxLTb8:lGQÎQNxƨȣPLM{?aV- ZMWi vL=Z\8 mZ`A݉#lRn#!|~߯K~^_^|sOumeQN4$4Lb;u=iR$*! $QMH 1`'>A gì·l!.8묽^!QM_TMTQwNGnVj)h%2ȸ_&|r _+ I<)Ӟ^>+#ǔ+m:՘&)R2h[Vvs^%:i3{=EefR`%`/~wF :}<y2;u Ͼͱ:* |.mT#qx}]0Ns8: CiUk`G<ӰZᤛ{KY"'ҽmI#%'n17=fOl ?K//1.y1]3]?;]y_j΋OsE,)9^d+nmߚbf,ZMfrG*k2t"1-ffq.\G|C=k^q8wձbOς?yޫ#`<`B.q 'dJ󏲢x5sws ZyTwўm} W⣑QC]TYTi&[nRJއ?&?F{ >ϙ~ .QyF"ۀF Hhymʬ-_'K>r)rif Dv Bհւ{IBgqe}9{"w`֝+uYsOW\CwI{k,E^b=ǝ'^BJ9f(3;>ȧHw9 keR$b浄d˼Ϥ}ʔ3Dk /ڢ߭jQl9dGYm-j o[] Z:=M*VqmdKwG5.Σwsx'+w6)|$ٛ0sz]m|˽;m+_kMWڕNf9mL]̌rO [)?OF8grbf.rƬ(4?7S3qKJjKmD=e,}rVw̚C3h;8U4wȿD=?>Ju#Ɛ :X3KF"s| FHǝ85xC\cX!|~_pX G% e#Q7s"סZaͼ% o1?Mӡkh1J:v %.Sx]:*c1R陣nz=W˚3ʮlߚmro]BmyB2;<׏Hz.HL}3 gRq "T9y(ϻ3)'x0zF(xUC)Upe~rx@ςzt-;h3w9rvYNy{Jv+{Iy;\X{.X_k(P"L?j)_צio&򪉯;^wW}%=BB[pwNBw3ՏfodWh{a/ڥ5C> ^*}}r ܻ8P" !VA{%!Uᜳ*1~O%3gck<יs$Uvj-rWb>asbpv?c 1$Wϻi;Ȏ#Ф9zJxWy/3K{zuZ/1 U-̣֮6ΠmbhP_*2r_i̸gݳwRʴ[Nc7}okr߫+^#]7՟9Lt-h+ș6=$^3ߴ(ж}92 *LŭI=lkCCʎ+eGǹD*#]Ŭ]sR_9tJR-ZjsΙSwȫ2mh}As3I='!}uuMQ-nBRNR<\;ڍq_ᕬU\WYjRd9_U眾ֲC>ehF.OmcA3(rb%?g nՅ }mը_%kPg`ڋsQvhSHR. T%vV#UY4sϫ?򪹻~3y2'WgNo3[z/"/v;JQ%~>c4٠mp4mc0L!ΥC<נX~Vs'?}ȿ[ jE'}{:}<8L~͹"B;ȅuz1e)fá/i>Β'YWt\(7|Md:"z5BSmp@G][|ꙥUQZjg~k;}#m`IVO/eɟ#C=>9~FlFi+Q> Co{RDЛ" lCI{#kw߈ZiS~%b6h' e䄵9Z S᩹xxʂ28#W ?b"-E-0Ab݉sά:{f\ R1`$ШhScX— ͈F=%zh 7p?MЛѷ&yY8yp8(5Nˬn>C낌Yy/z=?lzgO=`q Qԯzi {Orn/YBg 2]t`B:$ I 8~I-G%[H[_'fs~8z_i}oIfЮ;ZٔFOyڥ̆z9v#'p)[A[~1v_EnwDBdm:gAK)pYWFva-Ͱ,5OvgT5ߏzV@N JxGx7،|?̌I9/Th~Ⱥ&i>Z.m:M~0oT|EpA6^[گ M';4q+;QTlomgGy|cyte>\5?P69BFSb3_I#GÈWdʬƳ~kp'-imq^[>]޸}=zlºR^ƒb]ɡ=ʜU@B):ǾY߶oݼ'AɝiGm{!t;$)䢬 }hиJiq) o5k"uZ)-dVQo~"{ub9hդͿ 7#' WC]FveX5Smz#ȉ;ǡy:BĤ'dӴH` 2g8&b/2Rd"y۴Ns.U(LO?%]ŵ㥷8;לџq;ZkMxwyAw-uAl -f-|k~_^#QHGs>d_OgBϣ};8]VAʤU_lM(Gp~~+2[(TxyQry|dzj2ЊK晞Û$giY<1;K_zCGh26$c3xjTgQZ.C,6k'ث~vOQjбIVE^>2/((ӑ&+HSgcw* NI Edr)tWǭw뻡 V K-m0Br| s9}VoK=t>09/jHm?k%؆{rq~H GǐbxZ/ZKl ͵)i#U=X Q"?,s~PXӾ^ *|iҗD1 % ;)dK 7)зF5]u kצg&U |ޗOu= .16Fdģ 6l׆㑣֣Q#vgXM[Na~? q͆90!q_!k ?O5ex%3eSC1v&mco$0ZbM FR\C5F_.N;,AX%4BO(GW ߕwP+aC~WΓo _Zq[|{πI/( 7r+r!:.)g(6P<z#aa e!Y|Uϑ[$wgzc`9_nWW2TME?$Oҕ0rZ yzJ5##D?eA=no.Y<ޗM/^td /j/N^v;)cv槑`75_ bًa<1Ԭa#uP˹U-jgVchն:Hڃw}-dž^RZ;ҽbbPj [J\[: *X7PUYwYd|6;jǸF__4PEyJ<<T;KwXG𨩂}0 {7td]}_wȼuS/x{smѹQtf~+'l oBϲ#ǥ9'hWi?Sxuy߬?w|wic|TX`lڵQM~dVF~ G(^ Ӡ1%ߡ/$Tdy)Ɗ5|ghvl9ʿЯ,|It2q7>Gߎ>}8m%g^=G~9@i%| qLqq*!Y $^KֺRF3MUP_>ø\\H(=A[xQj0;}2XygS]/,dY4*:􁪍˨.keI=Fy܇^|C<?WUB?:ogy? }ho@<k+"AMO="jLldB m|\O: 'ij_#k2+J%-]UW|x4o y0juyˌ8y{^yA~a9lVI-G0?*ɬoC*OX:5>-l{qTηE#7_Zꐺn2ۡp/u|*͑muc|xXelR3>JU;cg:q"|{;sr?GROgm3">` )!0gUcLEEsb}ڱ8^Nm%8)(݄cp;z@v'rc@f^A| h[wRofEn~.^(ל/z9̔~t!tޔn%rݥDowFF:4̖oE6 =tQL5Qu#ߜBgSh}pgL{%G[`?aN4PzޏES$mm9g>.geL1d\l vEql٬pk_dPFȦO&^vq ׬MZK2]>5!~ ӑ`5BF"nN¹ภZ X}M13m|w6+>?דy1Rh'5]~@D&9¸61pe߈!&v؏m 8x,>=cm46z\k 8qT",R;*ƨcScؘS|yk+vs\xu\x?*՜\W<}3&n?7!wGN_c'yodqv 3zpd+&c.+s0BzB֗c`Rc+N1 MdInNЧ1WS_nscy'mŞpF7%~yя-v#]K,&C_hd CDپ^8Vu-~kmWum"r^2y g [0 CeG G#}>aG C\2Pد9 [rD^{_yx\5Cqٟ2-qOu'eQe8:q4qD-RPEQ\%;>* Ĭ?wUgmK̵weN狚a*B3c^uȕ(ꧠaOޙdvm>,nG1FUɱ_W:;8W9B7S>v.}=l[Dɵ271uMgW|7!fhPiXa~;w+:6WE{kAX{ u#Ж{K3cb)b/OsĊ-EoEfQ[ X zݧĬ7г?@[{v̓8>x-S= & =mEoQcdi3z+#<iЎ=BF}?]#&0x==ȓy~<5\+KV7gA9w}7@wo^Ux9;9qw-Z\T#MUEx| Z {rti%^2G.ӟrlXfZ7񯎺l.3RǶkckX Q+93J7qDU Ry}.F#s`mBuMTAZsXl#sچW?ul=B1h= sw ~FsG M>d20iC8Ϛ3.fl̅П5Ћ'FN[~z4b`V9/2ݴi"czcw{҈y\{sgvHgE  N[7Wس ilWhd8i[i3a҈ܘ6{Y۸#1œO%+Л03ߌ|r\Ơ-9Y3{"5Uum $K\Ͷ.~ۼ|[)]lj*T0mɃH?#znBe=0F`c.\8.Y.ɗ̎Թ=}gvÞ>G)MDŽF/}^klb9hXJ0T< GY/fObbҳA!?\yD~WJTs_؇O=8 !T‘[ <P5HZAym2g@x3F0[̜ΣE4᪵aUW_U5BЦִ/|Mw5DfIdMd"5`vRnD~fSJ)@eЮҘbᢵNC_ys/kIO_k;Zʮȩ̓kKĺŷyiC"7jԬcy~1YJ 5! 8dzk?<5߅Ck #c (xr|XkA?eߜϺ;i&&MK$N8!@BB0ؼ $@l`0~}ιgsOUYrK8hPnYjݖfQ*Kc`vwQAmڹg&gL=$G TwI'gߴP%Q-qE.Yȓ&x80Evi,UD^z;c/,wx3~lv5UՙRBE~zƠ@75}k=t5Gxb^KߜHrJCy mFrgEZQthk}źT&i8<(FQknHo][F&cGb*| $OsK?=eG̫xzɥ`(,PF13 "?Щ=Pe_&VZaE{UȩuKko#egf[WO/T}To֬ݾh:WV`O8"PC=NMᘲ&i<߯t^rlFz#Z6܅ %ɇ!vI"GCfzqtwBָĺKθ䅜tWxZ9~y5Hw:+LOhq}]w1siE}Jz$o$C&A{HdFk&ԝZ#W:xGR .OOT%h~zOog :Xdԧ6y +Q5m-fu^i7$ ̮4klEE@8?Iw1ߺj"rɡ/けfIkxdeŃ &ZETy`T*̬݀wh㰟FO ރn,ۋ>" xY׈z]Mdӹ2EqYz1?9EG>gBxєJ;^LlҐ/DLWSCB{%O:~4-ynJlUq8:[[Zx9\ x+p^sYsc;_&OXW_PDNcŚp ہCe^ (g(SFv|IpgW|-4YL~t3wsX[ϥny7wqu3v\e*AkyT6,, /WIeTa!SsK|B ۛ;O>-wBfvs1/w˜!69^5U|1+t%<1}s@93ҸdLb5"FX䓲5s^{=נ^K :o䗳f ZY.A# 'uւo/1Kߗ%p kVC+U !D闾AXluV){x<|k"0EYQ8Rv^n{9?lc(kK?wp9Ni,<[ H[W*՟JKko3{p^M0|O <¼jr;נyϝ18{![g"}QvnL9p/wŜK:^Qc>\WF2/اEC=]ޫM!EEȆzKeWܿ=V\(dž̊3Bjb#K=Y.5&;OO"}SF`M'y7]'o9YE6)8\N2rl6:ǛG9zTޡǜ4Wx=~ tMvi{.fE%EI$1{,l)5(u)-ydoKb>D=B? z=8uxMGOW.eTtQMI ^N 4 e!XU[QٵV«^%pgzӅwW{4?q碩AT?tJ?}kC?@iX E2)BHp #ߨoܶ_;kYesoQ5@/!]V/R.㌇BƻA9ϯn wwW-* Fس |mMb$1^SNö!cONKGqxo^Y;E~X||l 8tb11˝ _O`؞P>|[$-2؟Px\}㷍qܚ5_1.b8.~.s;Ss$$}sAS _ۥgb~u[MVP37N <j|J%Gkm=A*3aX@M濮8p[37:9u- 1isz ]_[r<τ7rJyy9Z*.?ej_JjG9rYL&{i4!Sa/) POGQQƠl ~.˼[9-:Kt9=e <%_YRƥoAX/-<t\ߡe8_WMsY1!Ɖ #=#YXU^ل5c>gDz4U1XA/5^BO?FY^3*W]=V4 ȨDCH?] -vk8Z⼀-jAGy-f}p0sYGy > SҹUŔ+;XCOgye~Lܓy17nz+쥷 E/1D!zף;묃<#}WlcM0fz.0\$oJZ5Tb( &v)g(z'bȝ(k)MA(Yn$'{joEװ |ߟ֔^M>F2&~b=̧k4j| <'c|iruߟE_l#`-y6L3~|?h7B7lMoo?'Azo1LELgj|\Gxn1ϵ?9׫|l$_1Ľo"4_kZ[IA=emkk{M?iژʏzW]-yįn|%-ԭC.^AdA4x#x o' !{G4۵']rfɖ1#/'mF]7F-j+I@AJ#zsf95zW@$MK4Ty<\өʡdmr?Bz/yFMj.k'!ߌQۢNqe֗V޸4ޡlhΏv񠖺67F6>9j3+buԥr ~p5طK줐 GT |W4T+E^>W+&Q<ǜ7ꡆI~?gmx~~N}=^~JۗSٯmkRآ|9]^ s/Kb»ߢBX@y1b”{caGH)[#*NHMEn?9V}4=8Vo$,ijc.w\+ޏy^gwkd1_Fz{&5U/9N32yAg }b1uu=:A@Wg*յy]WS$T_N<^< ?'`>hYѨ̣R YOl[؟=6v?OACT +[1Bowk<]D,CiV&]$wx<y@9|[sŷ^nU I/a.GoBwqձG#OٽKz8L} }cmRGK/XE/aE^QAcd]%u?'o|zzϱb'/`&FH}JK ~}UO1VM%YNƩ&s <-u}X9 W&4Z.0aγ)>Z?)=?s3x£,vk/ޑz3[͇:epl> 惠#Fp&5#cV^1&^948I;C#L^D&|1^2&nvw u~ 뱗[͸~2l_ʈ9! !BIpfCǿ}2R_D Qz3u3Г /Ebr*ﻶ;J9͹LeLlK;2$6Lʛ*W'ߠO"itĵ5A >5xu5""nϠ Ylj>ȩrKrπNQC5UJcb"lt;c?z(= rU"~Eü1;LXrU]B/J3ѪʻX3 )߮bR{v?u/uCtڲ:)k W$*-="O8&:e8uF ֒1j d"7ErӞ0L`FsktMK~|aQ?/C_Ж_nPQ[a;@{CoaWA~y+b)hzu9hwTmkAKܾ>noGavQ=.S >No;SN9[6ˆ{‰ҤyOͱ[~;var ac ڛQk􏨓7qKX[ױf u|c!8=1CXkz`kʹ2$/s˄9:e R>bA^s^u+jzԑ(_|IrV} Fymy#yZ2hDl-g!/:kgdo|c #hϑ'鱧ii.O+UA?B/* u/#p O5}x*Me,ѵbGsO|BB0VF#<w}:QKBЃ9'b܏xŤkٽ`\hRS޶Czâ>eo`&=cҗ_OqܧgvHOP정I/;+QQBN;_ȧ! H= w`_Dzy,,/^}.&ά!xȷF.OmBψ kIe=>M1ބ-81fզ ~6gptט{{> ;<-^/$Qҍm1Eu"- y:-xIh=kc,6u$MqMcۜM8F$zx*M])~}ߺv W:ӡK&*z y @k oHj47hv4w\niӖ/h&vwT6oMukIkS+&4ޱ4V_@kU^Zc`N1Euߓ]ˉǡxԝl)HCOʵ(;p%ljp$OdhT5: lYHO'r&Y߂Q `u\PNԙsw#Wa=ΈPŻǁy0o/K_45 E**siSgM}x=U?C98KYAn@}C -m&-r_ _Kyg1>ygX*Uin_#(@wJxm6wkDb3^N,ѤYޘI6m}#:〼 #= f N8*:o.f-tJ)Q=*c3BnY |ͣB>~Y[ W>l~7Yh;Sfm,[8wgy>6h g!gχHGͼ`P˜qD3Fu0A:wԏTŷhn-;Bwc<6C= ]tmEϵnfro6QV^u\{O2:r\<cHE@~K?wp?*jEՀ\a+?9)Z뙓93;:|Qn;_l}{ ||<|%5jrKk^'<'ߝ'S- b'pHr\ SoY/ۉ }y#y-s8 fzk7d}OZ8.7MpM:Kpg 5ot WS=YW{۩'^'|;i>w{': \ߞ4b_^U~1moM-e(^W}Hgh/?2kn?ͣ+eOR8q&x4cglkdY"E$$MqiR,@#rmH[hO{>dƼ'5ĘHۦG̈́Zb8,C}B-i6Ƀʬ[8/89]p*H8F&%e;n?:w _2hCjӔ1\vbdx:,XVpn7Z yK+{tyzgr;$߀g{3c7]U 3+hGYKy5+zU%9,[9cUmUxH&זOyK1ݺnpEG0M?#_2ȍI2$w!z"@̰U&V-b{-1+%OLTž{ԆG(ԋ`-.D(q/af |w9f_!{\jK`Lws؃/Á"<^.N4S,nu6 m}נaw Io)}W׬+LT)BzQP9SGlrͻԠޡs/% k\#Oo'gTkYW)uyR+WFS &ל=؈^+cNVה)\*_Y\zkKzcy=_C:$S8V'ɷnE3{E_̆x9?ÃM fVAA[ݖwdo{eDη;Ymԑ[~KR~8fZ7ބ#su@խ"Gc Xo {`kCPYC'8~C0C5_W{6[=}M3:"br99=Rя޹ցYJr4Q@.-/5빧Ϛ~JG%zӑLY)aу~e\Js9TyV2M:GKPZF>mı91^W&jGs`ƚ_9IT] f뼾_^}ܷI|^DcGs2p]28|y2MsV46شe y>q{[b"WQ +iޠjW6S|м{4?Y.[o\6^;_gGV@#c5[-Xn22Ps;+}$2GZDZ^qYi'㫹P#ru)rT>6?;=^]i2W\G8'*ϒW*=Lx 2UD\2áz4TK6_rkp\(C^䳎ʧkCk߭|NE[8=I}vm=Eto>0^4Ϳo:^%蛑;mdqN p QhCD>pf3'~yǗ= xڽu\twmC%cNfc0c"gބ3炧EU ÌW=k'kx4#c76] 8R7C1`p̼x}\ށ1#56Ǵ y#3Ҩ0W Q>M燉-b'M-;ܫɿ\C[ (s#fEh<]ʧ{Y8-JayK^W <}ʘsxW_yB+no@͈f5)1Rߢ֠$nQyݍ?;[\ܐAO}_{f@Ow^?ޟm!˱]4Y5h|bC<&86^Cw;kD< xu^KGJS-o L'Wϴ +**mK \hFgS3%NE.aQ/ZT'NT\+kc_ aQc´m[|zȗ2tM񙌔JtI+uM1$N}u77eQNTMuOS=nͰtАĉ7ɒ78yma>,vĜs֓<={7ձvM֎ 3<_5zMp |fwɚ^*t/iƣGCwCN)5/ب[ ;S}F,9trM{+;ûKRV0X;35N*GA05)teAA݆9ZS>* o {r Em,=ⴗۛu}1|G߂'Gz{z#=N^\tOb_>tjBXٯGFRхSZ,1Kp !P/Q˵>!5$;PPcԿhZ3o7rd#uxsJE87RTZD^5 C2D@ )xk89c"=|5+PdMu ^8qWQWvZQ}*`܁۬u4kwfiڜ Й~K<ˬݞNo{Ħ׊CMsO7>52`hl*8: rA<ޡFXmz]+ v!;y+r^7z|c^ܚ#?k?x͓_VDy}g7PO#½@i/&8&Cr-=`t'SC%7I~z9l 4P }2ʽܗ\u&3 V ^{35-AJo'3SAoc }ՠ o}]&XԂa*}a'&;Oi}=iS{grZbZ`ZoIN``>â'`2L6wqm&C5";n#[OlmjJMzlJXrȜxa=<0GqcL9a>w;x\o$Zr$Mf%3׼uwo/ƅIxnx0 Jv8YoQbg"ug^)w=$%,1^|/!$^#^Q< Hk>Ssu/e<r@Yx\ʹ30#ΑQKɥ"آLUs$%K)2Mm)MT&ʊ1M'd UFz<h*&Qk%ӄת7zy?)<_CGsrnpO-dAϼ< }o{ʣ IVͨ\r RQ]~BȚ/}C0!}^YEB}3zg2$L t_&Jy:{_hMwws3?h}N&@s˾;m ߵ4yiݺt79':   b. $@I_Ͻ3dgh4HߖÜ[[ˬ$lɹ-|v,sOqgu~SǦ^M4Z&R}:Wdz$\`O1 ,i4f~cȉ0:Əpf0m5j&,b}ˢRx+ hm/.fZw*1bmmwf-_ff˷-<:2϶VA;#fz~M^,3L2/^ :|й@w\ޢ$cpͳE'ƨDz2D6(T9p E8S>ڦL۬cC[ҴЍ`>Gh:Eڣp=-WAK;nH!};qr`\mtK_ ?d*K%tKŵpjKy\\yyy_z^i 5]uzqI'i2WC^J D}$}m؏퇃^4IġK}ϢVgV L`/ ނv{W2^R5M;Ӛv׷ߙ5-xs[}doCGqj&`Z` [f1y?姰: _/5Hͭƪ]rMXnK| 竱[PhoơWҴ;?Hך+σ+6,]&r*)Kg֕oBlҙ"i.}R_U.S\<eˬïU>hHP79E~mڦ#â}Ճ^t.Mpnv|YwS߮Uov*=Zi#M<1+N쇹u|ܥ\EN{t3GIc^JG N = =fع<R lC L֐ܛcneC̲`/#6/mhffv!nnf)O OgNncoho}83)fjʽ|NMh~Tp!bd68DC;\q1)VK񰆳^5`l:6?h4^&sg~'һ{ftN?o[7ξ4ߌ}Ouh8#}~CGsWٝwR{MO_}kg=N!ߤw|[~ebQ_ˬ~3rUߨe Qm)gS [?#^/b!*zo84&WśkF(IάI_-QA=`np/>&̪+x ~s3`^\6lJ\[AS5ph,>'4F 6}V*Yn2j0+A5 /m JU2$e80\x >MQ!a gl0>\_W D Qk&ݬQc+?$iDTK.܂5i&81 %>'/D߄ юw8[*I~0([g-O-Sy{A``ѪA{/S/wɽ ZEO9Xcr9 El6_Sӓu Z:-}o8SE=iy1Ź0ךgBIhk̺WL`yo |45v!ƱAz$ ssep6BзftLksgwk{p9JLxҙ>щd+Zz9֒9I'kBȿhfV{D@7k"'b|/wP75Oa2]D5iÁ/^t ҬSc-V??Y?Ij ̊ux"쥏QA #ʨT:yܠk58P+vO,s XF}޹<V\:Q~Lo;CHEC5ˬAC+8s>fR-6!JܑcF׮[͊V6ZЎsM{綿# T}wF?잳gzsړuON$Mm:&$,2Ɩxl =4ay\$wYXZZ CMcqz%2\gܫ'^2xRW[UYd"40kt)_u1/B^޷WCp+yҡA<FU^ ;OgazoGP}Kg Eʹiug <8ĥKӀo=Nۍo/&ҏ~89-ݛ7֭N>cж&/"W?rr+d`S[?o ;q\^yP 's?z}JzDMɼZ-G:^Zw%|CG֡OZo Qn9<6sFw^Xmy5$>*K8ʤgfIPRoh=_w{ Υ}:5kŬeBiUN95 ʁ795d3%2A$م o%T%Aٙǽ"Ki~ؙiq{]~>i*}{rjoO[MWz5`K3xC>k 5,Xy?fɼ%b,/9Q8QD@m2;M QLg~n\VN^ÜLÊ=[oApֱvp:ӿƽkE+Peh*`>FJB6В!|jZ} iBgO2!=ҞspK7&aNp VW8k{UhƏyEpfKqL)-\|BQ#i^RDgFZ+7ɷmcVQpZv멩_Tv3mO=>mO\x>/}7>܉q'gp xCֳnkiXuܔek7~O@(%G?HXmb9sG,"2|F@TYCs+𒹡ྶk։ϺȺ}}:חȟķ"4Gpw:I=_u\au}1X璸aA.$Z0iS9 &g5's0ޗG1 2zq<[a:M`1/S[tnvKK|//*~9wZC0kﭦ~c5i#4mEzxC)u{7 ] o+ t'9V/9`/Zg_,m^?ˢqټuoɻ}d7^OϿ {"jW` gySߌziVZSKĸ4ES%NP$sӉK> F_"OzEyrkt3)y.lduT2 k&Vjʖ̏Įĕ-%FLbbY !rq8$+#4H j ^A$g',5KXM`v8-v©vMf0^ ql|h$ œ^i89; Z:o`ha2yӫ!b qWsMZ9>ri%wgTp>r7ǤkO϶Us$m^75c|3lb-AzO7u]ę4giVb -ρ<%41k ;~T Ļr]m yx'cQ9N{؂}b/֤pE55g<&xن C5e}7tU9sCK׮I9(B%{c+m|2hK LU#Bl^8e GjrXk,GE\8Ģ[:^ѢޟsO{)tק5gM AO{09ɜKHWQ_ \:~zjg y MD2jݼO73I@1 e?]tBz!֤!${\#Ʊ>Y[>3 pfTkңnkHkX[muv:#V>Q{fkrMw;u0ژx(We\Dc.iZZ3&֡KkA`*i( ԟ>\>e$XOy=&}ҚHͭja3kq vI_46ۨw + RZifDɅ|͓y_o`"yKeFs:=qG>g6ẗzgR8y,V \_}1%ލAy?z\<^s8q9B ޶jwNuƺZքqc=#&Uwq^FhG“jD'_An5++AК{orV#M[j`kϪF77[Vjn3iSEq{y±^̻Gv\W_-{g{`i+ߡ= ``S{`hhU`5#>zCg5\LtгN#NvoW}` >I= ] pQKC+F |#}s c v6 I66o m }=A3~ۢࢿGb;54Tڜ6;2*VYofrsM؉ 1J xH9G8iZ9% >Q_'-95g)óuwsV3:fvd;ɜq59uy$Ki5#GU'U(?QQ]?iZr e_f`6MӂR` s-Fmi=µke;dO0t[q5}kzGga_\<'Ϸ$::sY0rבY kyCKYxa_]eCrkN>yz>pX|~.X"Aw>rRKF>K1yc>[~[cIOtOK [o9Ap6Ļ0({텃+tV+9uÿԽIRG OypsOY-;g(,"ٍ/3 >-%T1n){_[MryE2k;)6sUڄ|ܕooӷ^".h?Q5Ԏj -bF4o&rUar6,E 5Kgꮺfvoc?%)oaS؃ǹ f|3o.tdKrͬeK@佋A0E߰L{5E,iI3fȱy,v1@gI,<|'k.ɇ\=r .ȧ}$wh3ծDhh@F@%{4jיa SV]xtFt¯VԠ;{AЩ%uSx߆#ǹ{A=s ;Ѡ8eK.k?ta͡*(E^+?w)i`=V2XkH׍ou̸._Dtx:wr߀/I{EwsOC<.5q4EڭnL%-Q.l2J,(ǒ6oW eI}Le35ޯ}ϧ!?")׌xX6e}s[LjV<[ ?cZ:SC}کt/ەuں&_*ܟ_~ȉNj^a 2^PuA6S>_#b11~]xlP>\k'WNԽ 㨯<\Y^FsʧGGc &}.ir}O1Jr ϘYfG!"6u8a9?k WhZ(AO.?jNҚULze8NfFqk-9 sqZ+6E4hlQ%G~0n7ɇq(2GF=جK+¸mIHOg癁;bo_!̝ܣyVZE= e4f qHI: z0gn+hya^}tPxG! wq.] [ߐclI2N<֥/< ?3c֠uOeٽ$fS^kܺ6(orZNI8VU%Rh$MoIHPe W^#HIh03g?kг-ۉ)>h=.)p/ze+PsE/P]ԥPzD?bcjI8ϣ/ fWc[[ k5~W[zf63ZCnZ:ӎ@׎yq?ɇA'iݠ:u|YͲ $x.YbԙĆ+hS|{_&odtٳ`TO`I2ԓ#ruC L`N o 1-YPw#nOyޕؓn儸j#=oXg_1WpJkmh E]Iכq^]0{)ls0GpoD֠tkW>R7<^R~/:48J}4-A;]$е, FQ^otuPy|a:OI6&|Y|'nymkb[]#9\'K#)%`mֶֻeuwpԚ5L}`-{Kw-ﶸ m4{{_%~Gw8g*fw,>y5yS{K :&K1 s)*<sy:omڍ 8/#MH|n%IPqX[eh?[ಮXީՠmÃ.}Y]i]0( ^botw:: ݫ]w;7 c|1yob3 H{GJv"XG#.nk sߴq;"!TisvI>CgB4+|0{؜n .s&O4(ӹr\* . k_Cmg^+{7gՄ%?Tme>|mIwڏV V N9S~;ם|-îN-'WJV1,Q_7Y;k{nM2++OeM]}u+{ IVͥlm߫-cW]WNଧeyoi.?8{3}`=*Pn$Mn-g%}ȝyShBm ="iԞm M q~3% '~j`m(nÍ{2){8W:koW6 j7X{9p3"Z4_#ex|qk<ht;xX~y2^ϼF;y:dj$P%B 6':?=Gȿɠ]:\E:,XM2mt{57_LgTG`^>0'Z  hb\{N4_DU'Sz:xXy9xM6O5IAݵfDE07VԚ4gZ{s5G} P1}ޣ- %^"G:!>$Lڳd(=<@^o:ߤ=F Vs. @<7fh]>>9UИgAm>w^Wފרyͥ9vD?[` gfä}g[o>ݞ[~8AIGۯ+݈jRs;׽/1/@[FC{^ízk̵4v_?fwWJY:7)T0 -z~ vPdtHl=t6]*͢TB[.,`?˵m :Ln2n5養[7Iz*,ɲ($A@(?" #Ù]`/X=}[S\7:FB:Z̅5dH96wrr#-ѿAOf&k4~&Ħ>[r-2fbt>f;P_[[Ssche 'eNZ߼bbXo֌7i05-_Fn&0ߩ'y,i{z$M-[Lc" J:D:8ڮ,G3o'_e -ɼXA.ƾfŗ0:^k6`!`etL3&?QW^Hۏ`R9 É]C')+DZA8@]!9==o%=b}2q'=Xe ,Їę98W[7 eYw\`_Gۻ㹡ݟOvʻd}᫸W}b)ZWNRKpB.,]RϺň8ρ#1Bcڲ#;1 (Ir/U{Xt$:a/tºyJB`^qCqdASx!7yEd:אʖF]0/k0UcM<2u0YdNȯ3Ѐ[9¹9憽dP_[vt@EW__W"l/zoQoWIME4f89WBeDF>^\5yȓp/ޅ^X۔_2); ^˂e |h> TI)뒎^#.M'~` Ov/a>)6ɯ @ܕɷG b8%*`B;[W[ICq68Vۂ4ҵ2"?;- S8/|\c2P Q!lM h=S-'lzQvxiOЯ(nnkE>|vS,fLAULxVoeKha>JZxbX;sWUa_z.οP?WˋW蝳g.DztX_jn&thxV8 Zt'|r/iC*dpϤN\s!8Xܚw;|W[OׄřsW7D]Emך+ޙmmc!|}Mܟ!1c_>++mzWgeePvRkI]؈b*SZwCl^]K&K~̲Yh3YVyAFseeU7o ":^ڊܳԕckdWîXgA`9hV_^,ŝw)jym0,!&_NM0ю [K s+tkۨ &zkAcwvN| 'σ韂)ҋ`\ =d8kp,gB9 L3mg 5<:/s1O}1w$ijЦgsb,7(: m3K }h.i\F3~YAq1M m=y.QwK~GNjt]MՎ\W=&=۳Y2_-g(=\|=?,9 ?;j$}GDnR^ a#G>͔xl"_3Zᛚ>mJ,!FqB漶aIa t"Y`=dK9xԆui1x5&}[h)۬?I 0qje`[[C*xJ N'o"G X/s}K|ٖFbS0T]h2j#)Kt(&1Kf~`}EϜ3źѷZ5ͻbwi>eNOCߓ=zR0Τr59>IhT~L*΃-"oc݋|U<}*z[l,јR2`P<^ЂZ *G1$fB%^Kgs Zg rwU5QGlG 3kko Wc[]4#pjôz 8XX?; *]n9oTl^Iq[eɖMA E}AQ]3`MN)(sϔ{8Wrr9-}!iCJtT6z=o~8Jܪ.{W?ZTcӓ7 #ZLxs¯[{s4AiQ: 5}KuԺ[8.}B?lxXv=8= T%u"I=\LuU_mOTgF[4#ǵz Jm+tз t3"Y+m+9K|Nf^fVY۔EmφSͩB*]m|b9ͽ@N?2@(w˞s/{Гmi 9s/bMZTm;\܂5j) yu?\̧hN˞^s93н^qCJ3 gYgT=1uNUi8+{\Jq#OJ~}Qލ۶c `}@Log(T$ꢕkk}c\KN0#{r}{~N⻛?$[w>=s~帰wew>T|өB4ϼfC{ڐ%8?ڱ&#_h"O6$rK γ-G[| =TDJOY 8רT~l2U[$K_i6Vkÿ~5&}*Of,*_23Zqs .tGp*O{]c/E{ʜ _W܍f!wkH[]+Y}6~c~_yrZi.Z4Iڵ߯rX i d߬\KýU|Uo˳,י,s^hzqt>Om  ,rhjWoМڨͨ|}~ewnc~}D?`#p~,JnN}yxo쉏n kx7bo7;?ܶqFۙΤ8cי:m\udYP@H@(Q~II>$s)X,vϾ{8&!Bݜ'7X;DYrtx$کg*.<9NWni#O`WL%IuuY:Bo|Lp]s.%sf.SVTY6T߮C,2F_E;zEuSQ$%1[ R8O 2|`eA;Ȼskhtg9FWä| >Q#@[ ^ʉi3&֤8ԭ'WI%pR22)OA#h -Qz zr6t-9څSbڟ;K%e9HHC~By3 k)r]!dZMg\s+Q ƑԲ#>g5]'ioyBc/U (-C}!DrMM-VECڒkKX.QeyRyo5s7l9Ç IX S0Q?Ǜ пCA}<:mYǏM=ݤ鿹NjëhI%5&FgN|!ٰ{t }yaptTfլag SuV}1aG>N|)9u6vsyl*9q ~7uW]; .3- u_q z/7l$2쯣g ~W}tFtv8N}^\5NQغěQ꧙h<7%u=SRlyS'=uDK1_cNd|p-<9Hkqc8_ °}D֍m]m6x%`-nuݴe gӦD=HXiQ3bۅ1=%|s(Ms8 zY#gϞcA+(hZ7+_?: #>NGx^]G)G|uPUuzWbu#4C\TC|*= IXSε]8G"꼮YG-sR 5֫Yxʹ64WI5׫ޟ&՟g>̚ړcumggO׳v94-;\Z\[z I +]'.<1Զ;g1.ܧyVir"9NJaTpͳo/ FRW]qm^A?fE'`%W(]+, +ϫv_ɭzA<BgZ1+Csʘ_M,Gt9kإ-}Uq38By[^f^Zcܕ;+[˸̱Ai"?>B˒_I~0`deqyQ߆fӆh.|8e:6[Csd/ߣ\j0+Ag;漠Sp.6h/fޏžak(!a/gL2?r? 4*?|6gpQ2}e.08asͮ1ҏ#셨,v=뢇F 5k?/+ddYIMoG:uYCgeP?%Mq Y!6Ti7\#|$"I^H˘7^?Orv̶պ=ӷsg} )kaLU $ ԵN9D;KF^=Ǻ~-OT/,%<08>ˡwBɵ^ Xmh9xG-C3f`{~"Q s`bn-|z}ti~!g?ךY]{8i_M$hƿ3r6 iha>~M_tmsċ@o xZМ䤛 mn4Yr}1 5w9+fGbp8Sczcߗ#:5 ə*kϚ^H?Ug< ,_>9چcD4w.gRid8+Ow6#Yg9%SY4RU躄B;C-qcr0z3] r SKpxwn%lgԚkn_iYe͕Ґrҩ87fєXrmF'8Guv9!䰰g vϙeͲ ɒ%eYcc;+%fߐ[1|SVwuI}^&̙g3zhhCͼ_l8b {as7Kq8ѐZo]d腑0̡sط/T{-isF3QȂr O~0x%Je.T`_N}euϨ?a=YW5jܬ1~*]!VcGܩ%6W|3ѨV VUW2W6Q&L&\GXUH#V>jסk8XFжun z:^}a]~ު_3:0C똞[ơ UmWUc#B!dkH[В9ʇCЁţUPxޥLқ8ơvG8ԟwaE_JF)[tæZ'ՙy?žhkg+FF0 &O g}1fȶs5Εcug zM)0w|]辽ބ :}sI!z>>%%k=)Mj|ĥu֫)ȃH^V?9#D]BR}>ҬțdvwKJ=O܏e slE|c'tRgOǾWBC+EZkm#W8n{2:Vio!\9<-lEhIڻ8ee 2ˣB#(Wmavw+z2+ГRgr54E]0IrϷS~TTsr, zibnS= gr; jsv꫉ea4z=?spx-d'&F. t sWBjJg <^ &]QۋC0{FYvcgFp+u ;=8+tYl6-5ggIҸ:gr3 HϾ8'OWpGz[bbmjC%=ڂs-]y tVw|^ 1Fo}{Vp-{8jbME+ȧEVL53(?og^(n'+~h:C j;$Ӎ'۪S{UUN]O>{P~l3dXW{-e /Bȭ\qtSϗyngPwU :N:0SIVXx֗ZEn~d~~hK۲k^v[˖vm֮/_A毤iۇR=Cŝ`QW$U!t .{5*Tq'n =ug[b ;h^iUΊ_޻9kց{;XBoh*NJF|F:8/_ 1=F g=/MMoS{0:7mSq+޷n˻-!. \>%uEԖ-] L^Wc:*iįz!\F+6`5[*-_rPmO?yK_^o,=֪nx lLr1$ѻ2̉Æ qX6wzJGK]yPyH I&Ru5uS%.}@-V?Ь#1mִ ,WgBs kc3t YXWN_9]1Aq _!cK;Kg1t[^^VN/Х(ÇДϪar9s"n6NWħUĬCGT|y=h1I6r؆b,NMƜ[ò[ּ#u~+e=[䆲ԃ~8xp-3y7ar.1>p>-,3D"a\=tJu L0ːmRnJܲ^;_O!Gaވ%²pк=P1\Ci~qԊpxoCN.Q 4C8ۅ`ɩ1iz^v:ۋ/FP]\Mr+Vc;wM[Taur^gݏ]JOvkXy=P2~SA|M6 llqlmAro QQˡi`73u ᱉.4O5Lgx#wҋ`#aUǝrnYQ]l+B_|y ѐ<tano߻COﮏhW=ƙ/1]%c]p'655EowՖ7SUjXE(*k2T #dlkxϓzB Wgl2ޖq] ka!rYײCGz '~*<ɍ>~̿ݏA z*^b䟠l/.Р\vxxз{ÞďA7aO 3f?b-*O)w%Y߉l?bޣeK1V(ͣ3P|Ke_%?XB/`[Ϙ,ۿ]K9Ӹ=5gUb[ygT)1DPos9v5leL%?5o}u!YqN^8u.Ovv-U1]2y2Kȷ"G~ ߰ԫPʃmZ6jz8*6ɹ{bp\̀גn95gcs7zw3O}I}}w͡72Sju7G\}1(dn>E-;#fO4փ v0lZҊ!wy?Okſ;o~Qן¯~X0kpei=a}rr*!? 'u,G8Zḵ,/U6@$4Rom\ad5[8%??mR[k*g Y;d_R^M>}>~ ꪹǫ/:{CƼg_x>{,`S&tKֳ} &C<_C!> s\606UJ67Ζ+ٔ'm</HH@HfA sq?B09dT.}Q3^`KfR25#<ϝ g$/O%=v{nV#·[L|y2;_zW|~1w03g`OVy7^5wjMb\~F Bl{x|}m)޳ץ:zXQb.V q׿XæWi-ObCkzo8%#{1]@Y5{c-s]E[~}Xƫof-lxP~̴߉KWxOSn\.9Q=܇\xqwjʲ[E*8(8t.&m%vE,b?hW͸] zM ^3}W̳YCȭ2S^`{c|xns0fAAJ|YǴ78:r٠7w^?/`\Jp38K۔#&Kh g;|96x Ll LMb?.b\ӌJ'ȷ 7"KBȷ?on1Mk]`vA Q3Սnm| 'F8PXu~tӯ鸏o7ƒvu:`$a}xx yS×0kȫXQ_mȽjj7Ϫ[Pv x nEsU h >UGLc$Xw%F5fpba/BEcixO}h3|pC#9=y{GuL 'CڑW縨*HQ4yOzNDԷ8}쥟$Sd$w<{ˬ[#=pe˺+yBSʼnT9uiO%N,'>7L= MB/[ !>ڮH4=D4թḢJY>'_fheQ?(ї5|&.KEE=/ #t :M e0G Zk/9y,~˄MJgO74 nnw2¾]-8#|#:³%@e73pQ6^ӽV2;h`dzȇMȑ\{F({[ E/44`"HvlD(QWZ.~$epf8swvQk?_KwOdhP_ QHv>n UIͶL~+g ^uSVi(} ˆcTeU!XnboQWF8Oqz1ܒW D!?^Ԛ5d-ϊVB]_eNy?]b^Mc0$9OV1?wTK ܄1Xq^+$v.XN4El¾?0M 6i'FC?_%W_7e rgS8ދ;0@B $b  ŴYwyר!ĬVja՟9݇:ye -CI9q]3UL\JmcGa='{ Ir'VgJ{@ dIlxwu?~YN5侤M+[`N֡Wlk xYu4Vn֪ܵwgY#bVO=lv$tOK| vKY<=∼265vĚ繣KSܒ 'rWnWf؎4 n)̔,1r=h 26I]c_1xK/|*OY4 KWԢ)ƒZ<G,#\(-M},0O$VyѬ`n˳4۰-{ϚRpF+Ekhk2 !E~ &ϲL`,_BLO c%n9߀_6ݮE^s}@kn7>Ԯ?0V=:3,I9Sz(^Ɗ_#p4U NCރcy|UdZq}aܬ#3 @=\?|ޟ8c-_Q~5Yc>Tc3Vr^?ͪwT&=tTW:vl?]]ڊސDR}==C2xPriMpV셳,ν:sG4}/Y搜tX~"s;4o7fof|c/X^j sJZꌼR옉= g~y|ޑ(s3޻N-X w.m?xu;]c]\z珥 Gv6cgV,YO k1cS}wF]K(Sq0ηPj#_4Ѿ2Wr< 늢!3EGuۘgEZ>eFo(-:1KZtRomܱ>@=ǎ{Aث}{@{ h ƽy牬XYi33Mfn"dZ#Fr8xv +Wɚ]$<7зܡ}Y1ʋӛ/c}H51֞XF//}K3šdVxz^ra[ A=qS*<*u?.G̢3|o䌪NW2>e7Z6`K$?>7RRM̲u 7dSs|/ B?o> ߊ!O9وÛ?{uG&˾i!d;K,a^ )w+ Ngs?ok0ֶP>C]j91=j{*\W<ʖ[9,)!&~z$:vD|c'NI ,Kn/ \Gvdo4X4u /u[j=;j,5‚-ioO'`Yp->܆qoE!^sQ|ZX\sɕ?7d5E,PGy|p=KRCRL̓q!^Q8*qs\ ׬=55$xҨ0TzW~kzvU5G+H{D\P׆b:zjXb E/GOXW v 1>FisMG_;gϱP[>Wj ?Ip^.*A9kD5֬u3YmiMmn۸ovNNҺƱ۩($+,S$A_@ҔA")JrjA9wWr>.vg=Oƃos^.5yڄ}hcFgXdZ(‹n]WjI#ꪧE}DWC=;jhieo]%XAs,ڏT_{;==+J]Tx.fD7гI ϠgFVEtͬBF79N=}ڟ0jTNd^$@aVwKn JfY%XK;K/<'WFmܰ5 ْ|pqtR+=Y$aN~E^~޿q{K/u/r5az}NW.*>m}>Yl;R}_wwn9/Ƚ G7KM>zmZÜfyP3l:,zΠ5pV' QQ[5MQm  k/n9&hqKCpH4.aSgzd|rOrƪ'\we_ҟ~~^wm%_8X@*WUD $AW*'_C;᫫+u^/<ȳio>/T~cWG3$,U']s+{Z(':x(w5A`]~l|V/Łguʳ/<8a4H}'¼C94"J{_I^ըJ\j=0=軺kmUP/;7Usy g{"׿/؍GWq`" ̵2p9h=CɄd~1Bjc'}Tiu)߫vZö1bk5WΉO~zo/s+Y_uk<`>G]܉܃P/z?-?F_y][2;ˡ8O/?7؈ŷu,JMk5-9SY~2\فom"Xm\a uhyŽw~Bơ+/L]|ix̑|ʃiUU;)<ժiǚNnŚ_zBWs#P2*=$cѷW=Y6a]ڒw䴮xy-ws%'Ț?ا<K)Psgk8%,%\-q{u4Zd,8D.;$KLbֳBC&zraQC۫ y k`r9KVL5$&37I@sܓU֡moK$,y#֘;Ya<;EeP?DL1Ƌ$̼X~2zJZ64jlIx ӃHH=| m7juE-C*N艿2˨i#tK0AH?j -o}air06Wjϊz;zs?AN diTE OWsgސ¹'z :JY&^Vv,wM!-ќI=5>BΑQϘO٪o%LȘn9klc0m.r̬isi?̳ș^sŬkzǩ X,B0Y`{2 ?_Cӿ2гy{jpctjq"hd7^·v'gf'kƃwGv%)])Uj!#z}7>5@kURC˱p>>{rsJ8mqej]-q",D!Ӑs}0M^/ Cz;F=mK\GjmEVoڗ5M]cIՍN4/i`m̃ڜeȃ&8Nl2^W6J67囱Xە?GnoounNGt3gJ8M*˲RD["L$J{]kq$J=Rfvv7}}4[gy?axGb82&c<)ಈus20Mpa~C~?k&i c!3t>WףxM&aK7%EM/GK G w tO4q®RM1E/-p Vѷ94Ǔ\1xՒi$t21F9r+nn8(EGcr; }ݩnͷڋU˪=]wξ^5aaSc=:AGw9a @:櫨~x>q v;f߻ y|w(4*4%ΚkrϞq(Ir;E]ć\~blրa ZpτpD{^[{Hb7k&EX𨎒v²]a.D^EKz3Vm kidZȒFj |.¼XA?kzx`Ւ:sN]_p?eEzsb븫s(-u<᱓܅WB,y &,m[ɦ[8Y?;={饿 E(a gUb+i3?hXp |rXyߋF0(:X_wMb_# 147l];hÿA8PH}hoX^0`8ǿhi9ec)̅d&1r{c=;~g\vf|ψ+nMܷw k.J‚[qu>}u`" S>}=[wuSj}=~~j~L=XΨGǸ00~D^;GƆ{& BW$|| hj\ףAbcX7TRǕ)ƻa~Cf6sPp-ov$>n7 =ZܩB9ۅrp#2Qr7XԚ% ;HQ"`诀=GoQ(i~|!hmG 726|}' Uo2ݍ&"V?+6QOxNտ3C}E{Y69&C:gΌ6w/)-]@[\Ynw?w<7=s̭xiCt`h\n!›ƶ,7X?'CONH@?$V10/6OruPrr9VE7rk >3ӰWLvKJa&S 窲kdK^H\>I*o"g;xmܪvVAIoNw. !ٮ|0laW&y* c92ֻd*p譁V21u|մ/L1Q8=>[Rk6kYoot7ԟp~m4^ْ_嵯5H18~Yuq?x_{_WD>o%Zb6)%O/KXw%FRZ,tK v #M-y{#S\'MmĹZqDn<[}HC jҨ^g^KjZ1,\:poBO'"N0mq,>10azٴ2o[uwh9zv h%q(h`l.[J26xdێ̂XolPOz 1qf-֥i>ř!~кk{[ҷ{mur|O]ud|+۱@Ǿ?=SWZx_K9G}uz黸}HZ h;7ϡ o q.%!wS?,o1]$g^6R*s`Bܩi"OPʼҠ?㑛~ cpP+Aڤ@Zw0=YO+{A?gBd> c]8 O(߇At˓8H{Iv0R9b~xYEKc.涍+ δ46v56qbEQK$^$h;WQN5 #gW&]ٳߐ_Q1Yy~(sNeɨܗ;'C[GS|P1[e0_%>jþ!KE0fmN栌|z^~0wdN`%۠me;B3r5y,k PT9+׀դNVMM1 ϭ) h7GЕbN 9Uέn,YEŐ{˾^e?hOW^l͞2kL O dt4.V0*nw=xfb1.?a˾lٳ.{iaȅAc1~19Z{̥:&ͬ ű6ݝ̃R7sY7Sﴩj[[( Pc'7uOaCU/&Ϻ?Z1U|c4uz-c)ctw ֖*l~vrKcMSXβc~sr>Kv(Ùtrf4]0~9뎚 8qPm+yeAE: s#/"YƷ+&^Qo +3y" #0fUlwXG2{pk#>;wFۓ:)k?=/8ǻ݅<9Ѯmq0>#ſy\<eǹ?9/8)߅j_ Ӊ`ӆ_>xjL40ɵaMe-ę\YqS!gBC8'0氏M&Vr3x&lGcMZ C% h SC.{ԃe$>Y pg~xk؛va O umY & F̅?'s)P ~/$w'>{ycmُ?G|]E04wɁ|c;W1,VHGԝF32.Liooi AIu ,pp;)n")R$-J*ܯș=Rև;缏wu ,M9ML9\ϊS cS ~п7OM }3Us&sw >kik&Nr^ {:[g78X8?U7hIcM`#ޜDvճOOpw 8yY8&8`3N$4`sH'.tXZ4"QMI}I6mo!^WJ|6 IV S>CR]`.ekad)>}rk7Tk,$'4Nio-:WZL$whsQ0]FzYG-G35=&gj^KVgƔ7?]v1V2mVǍ8q  m1&\ƜdZK)=kNJ5|vr>zxi{!2Q#{,$vТ1O?O$/rW %,CKy<_'?\~5v+I_:Pr̶mCv=s{ˌ?ypK ˳-w(}U80Ae(~~{.^6ވ\D`2k;pc"i|zZM9|—v]ʪ'/q^ټ ¦+ϛLp뛰kLՕyuSn"|qk|#O]9v Uؖ?+r8uDscbXrOm!cȁɵm~?"y?s{Y@}w\2V²u`"LIyi;'f]5@B;<} rfQ1w i`3{r={f9^D0>q [ly7a)z3x]}<|.sՋ~G&S :34~O,Ga'I% E#o)- '>'gh*VkGTϲj|TI$.rN4Ӗ9wX-{r;E!̺Hw9mOEչ6Ů8g:g#ǐA}/^8!1f~&kHa񆹧eјh9Xmeݲ_ #aݣ!1!{1P_-u8^8RxWn11J.j(Ci2Yս/؁-nx4{pL=[h¹[.+qjTc!^AM3 q-o4ji3q7V_MeG_zC'k{?P'~:@<\#:&9~ &I"o4EyXf\4^"=$&§ }%S-uCVlK/q koyƟNMoO#玴dkɶ0܅ۚ`X d&7KQ?|s 4i; Mh:6ɭo-0~F ȘGe?ҞinxʒLPZ1x3뉛 9͏dPvv5hyZZvɛn79rR{r>qcfiS=`'&}nk5)@{7gqg}}coWe'pٶc}f=&3GT`s[YO"U؇2Uג~Ysު o+*boL.} i歮^=m&*pѼhxU-ݔɹyEQ! E,/F.> sn3C G umrG8Yz<0rYFl&?υIN1Ԧ˜ɚ^!lX~\'d-;RM6fP>/'-X|ɗ۔Ir c~L}ιb,!~w#S+?}xڎU'' i-sW0?ڊ9n )%.O\5{˗c<#bFG*mH&?F;z&&+u*dĿ]ʍɺl . ExTO7E|{nL<}{\-'XV+=S2{.?'{[fbBSr v r 9=U;ONFW@M$4hGW 9ѬcݭWvl+\+Pgڿ*-,oH}]#+Mwi[ߜ^(e:'$W\TW\o!EU)Ĩ1/xQEgjŒ )t@ܡ,k73-g=mpOZu~k57=;MWy|߱?=I8~,YhT| IM4+'3=阧- [^K 9OܠNDn"9g6ypL{c|6ttԇ0]=MsP B;`,yqn97cvO @оȈoh4&g"K f]m ̄`?-o U8Ouv.j=Q5 &+ӶbKDvV!- %Z r"fȒ9ڎ\ GUh6#tG7n]qݵAQ2O#>fpN<Lث^6|/H_D;o[~O~[ yԮĿz6 }*E:kG2je/;5˳{czAJ+$%Msq~v)Ry3UǜxQMxn!׈f eaEy56R}+Axa5?# z ˀQC4)c-GxVϽ6a9TJᨬÏ ݓM~t=id1v?oXsML43ObOXL: [TȦd̸P~'"fѮX.=2&[,>E(Te_~6.q$њh-noᶸNѻy\8oN6C_C:L<˾/G+GdYs8Y:)bcBcO7kzڝ}KaAS6M79{D"={u\GgIuIHmϽwB><ĦJUzg>,L woy y>*)gs.c'&ٸ|p5RahzxIxWl'[M8܈ '&=d߮Gwy;תK OE:}+gLKv0{R[[ϭGO۵``fm 4mZgLk7*vcGI@IHHɚc"RCw%e\ٻۋ#wZ!&MonE}z'AlkVYupN,bi2$UdϮ‹]n)K\ПkHNx/y`5a_?3.ăC^-`PrF M kb >Aֽ5#ox)5D<]YOOS9,H ێUPg SiSt? /!X#rޜ{1r<MZL}stTO~5a^pnZJr05f0qY `f&10OdW^-k֫fNsƱ^ޱA<5&k(]SNj ~0U¹£[6G`;<g=5r=pS8#rvWi oƺYpaw,oty35fNWn7^̺Y~6w>k? zSŞw|rf:u$t&އ9' h#Uajã5AhB|}QD*А{ԈsbO'ſ]&e_!%Iuh)xrvK}ęWZ^wh}uPrá=ҧ^ܻ1K{cE_UXoTa:[KvՑmETg0s/aX)6x+OI:p ~FNOn1wމ?~:o:o>@1;/~n?7C/R<0&bV4E`O[b-2U.mR9L' +ul QkR78% C:~WߖGD'q\ Ή:9*A9ueJ?A7]?(j,G?^\eW>4+ĕ5>spo/Iz5:g,V<[%`[-N8(!g*4.Cӛyv9&qdO:xLl_Y)F;$_#m7C/z%^8HlF>yt94=o=u]n3WN̽v;sj88>k/䖜Ё]3VxLGy,C%y*zw~ 6JD^CsmEȣQJ2Ohv{k!jX+Pc3\ų6OX'R<ǫԤѿkz? iZļI_Jq>νjenU+pJ~uRؗ99Gf9SW"[ʹ8 9 oC@GL_WsFg8F;|WԳa Zqr!\Oy^&K;ɷ]KƜo-#qQeO ԮImfq?2g8 9C|׵/֫U35/+s~*ϛg˖7pR=a?Yx,lM,Wq'/}ҿ[ʓ&m"MxJ<[9FHׄFżPkarh`j%k̫hF!u@z 8Lt9+1W6iy.Gc׃7*kњCdZm\'7rk\Xmu֩hɻ bn ƹ7]*]}TUߪ7S1Q;8ɁsM+l{g C|qq^e-k<.tG<dU xtk?oZhxp7EPx3>ٌkod@ ~) (Ra=̧Ui/eWn2~HC,~?~Aŝ/F^J ;TCΎvZ Q~UΞg } u>=B3-\5?QV~))>2T9H NͰo*bUJӇ|0<D#a7gcgjHKfEaI?G* PgP(8?JploЪGE,_-`vV7]Fjftl\\,̷NTw~l{ݦݴ{ͥYn&qb'B̀$269gFOyÜh4i90KO C;!R< hB6DtıLEazw=K82& [icg!hl>^C,Ia/^_# ŮB-z#LYƴ) a%9wͬ@Σ}2`\s]ɰK{#瀋R=[y+9.07l}%>LԼ=3hm+=9_<@Yl~coB5Ѧ9ץ(^WhjU⋢ ҧLj4hܮMd; f|ijjmc Z1EPy7מ,C54v0D oհo5հV-~=2jRuj5\Qc :ٖ|<`z{'A4_AJwf^#*{L*>8>sCzk&8۶aҏ* gO1wZ}]O{Ox֩s:^|^5GYgu,aֶ6mkl\#,jR:`#qhTG6} O]~m7b(Da2ijCO:.rl 4e5Xa-2On:bK bH>}%ڠhEp&˕U }D3Ĝ,(יOu^kaX}1[xbK*Ik!{II;St:kkn%ߔ|A Ob]Ԗ lH}=gW# +>7WINə{x^r?5sj|y5M[Iж~YoV蟞mth>, $5H9n[oB<saj8CSXDZ.\OM5I_gmf1fVbh{dx#uru>\>Ɠrm+eVd _tj #>We Ze5%ռxBnɾ{ޭBjj|Cz3S#-ri嚌Yj/Z6kQۈ6\;MtX;aΦ`Cir%EY6OT؁ N<0+64h ^cL py9G3Cop\xNȃ`To|}:{٪Oo2>k܋]߉SN=I )eormje. 9UJc0EQ6^3U8߬";*ZCgϋu~~;VV43+I]0 ~XM;w<\չ]AKe޺/}hר;\чѬiNb}ܒhν jWɹ9KDdfv@a!p [[oW}pNk%ߠN۞K%3?83KXķRrY$Yó޳4j9﫡G>g:N.h_5; $M80:o{I}`;obKwo_a~n%uDs>_.9WCvߘK]YN>2yuqo  aKL~Y*t7frbyqnOa]?XGGjpPyhߍ+q_#_a*,\L <zw'"XF9i |]UރNu+x?/ dOBG ?\ SѰ/},Ț~7hW%f9G|:Zr˜:j5ZpNR;DV-Nf'miZ4;/^>ji%X 3٧EiXx緝 ?O-5=SK5,}/Dx\ 7 0ߢWtl_,F¤3{4am }5E|-QO}i{2-k1& )圱h+9cCw3׾D֑,8+t/a:VυLޝp/sgu'յͽAy/*LK]-ҺZoi s΄1ΒJԔMѵUԨdtDS˒s8Ke<ơaCkIQFUJzQ"p-|wo1vd9>^aٲ<4w^m@c=;j{*ҏ] E4s9?,=nM7ݣ¯,_~XajN;]mg5IWdIqI؉c0W 0W!FF @%woH:NW`5o4hzxݕ_ŷ+cKCy\_{;ڎGmʃm:!9O%e}Wtm`TWm>%G< ֥e :rYSVE+_"j`kd$>#-6nNC[e_,y'y7dލ1u-j2A؋Ƨ[pY=<kzmur<>0ĹP.4U)ٔ9 yl:Mi;=5ɳ\U-'xJo#Kx(_*#u"/ _H>_-"?a9:=r(wy_b\}!VŠwrzvNUQU0b~k XЫϖ^KAmz5NWI3gG~XOӈhe.F4SAMCww槆O^*-*uI]J (@t#:9~r*|-*:/)!hJʗp]luPiO4q㑏a4"ԋ+{]b_Sn3uѲj^7TOQz \"\ߛ5yDWg#qԻ5}7DZr?'߀LR s17q6\X88jrϱ[]gst&ϝFbVb3]? /;`X<%LS?՗tS[{ }jl=ƑhROv [^MqG㧶):׶z8twB[TO|XB戹]<|ImQf/C6^=Q-M(Mc W^6cFw˝GLj=9;ZOf0hT_]:fN 7VK?.Y ܉}kRGn7[> ~xEBx鵟-=` 70ђ}nk|mCl+-C;C8{RI-3\& F4ϴğM 5%+Y=k![|?`x LA vxW)*`y[<7k'ظ( 6nD+VY!fpXn"h6IDz:F#yߣI0OW/t_/)Uk68#Dnuugvugnǡ~쇅|=]ptͣUM|Gc<skq1[* n:r>̍Lg_/8"F?_5rg93 tpOhJh64C 3UF!Y;|Y˻Ko#؜l),<5&Ly(J?\耼j+ZZ=.qqyL^)D,Pz)Cnاr!Z.ϙتr/O9ýWcv}jZ82d5*'Uٜ;W 㻹csK>   rn00{DLX GzD%Stj) 9Dj1(Y׋u0sJl/y/E/r&} ={SA \BX5'[,O3ǵe /Hy4>7m?Wvur,Wx)f oT_]^%ScUhhoڔҫ n3.751*iDM#fáq8hng/Ny'ݼx2q~ˬ|8UoOwW^[Mq< k}OC+(§J<X!}RQe+%+Pϛ`&|_&mm?hz6%4~ㅓb?ӱ/x[m9OiCd~ &Usuſ\\ץr2>{Cߓi*=d[Fuo9+{(3ǹveS9EA'7sn9p84=:-U2mRIxwc=k{mO8f<㫻ݶB0KDs9ύoftCF Qu(+} >OWZGOΛES|Vyrg[/|P]KXE jpװ(w}ʓrߟ-VmW$G#ON33p=K`eǵkh=> Zt1)̤wj zJG8kpDJk+-FN49t߭1f[1VJG+T̻2/avhp5Xs膞X ?C~[ JWh?Z.{gF֒=uy?7ZKEwz[-sj <#4T6alc lm"Y_wF<[LRDQs!XI4ϭ\/&QzџT ?/?3Ztޠ_wz~=Q>;w vM<H{'glzMTcpM/m1!a+N*(6 wAߟM{*>7O7Z&Җ]mHbKP,ʱ%b=ŘEaLGjw|7$ΖETl69ݺ2F;ZgGE{8qwbthW*.{"~@I.uj?WU"fT k5a|sS0C_۱FSMӬi!,`+}=<ML̒ǛӔᏚ%ҽˡ[[Emsj{KS{ ʏ+wQg?OYJ,p|?fqW e<}̍,Y,b5 bȳFw%4~mu4xPEt9PEQy=ic@cwHA8͏8ٷMe?vOp_ΰoeG~$v:Sufk`Q@sNǘ 7f?|}Ù[UոsศRTƆ!kƑ+cEz'5!r&~gY+‰~NwȁEi|o=O3'-Rpq}[K:~ɳOO'~ʉ}O9Z [0nU~=1Ȯg9ȹ]X6}sm2дSG}=s)00n=ۤG6 PJ6&4(nDž&Ц[].1Gu<'ޚZ9kĞ4d8|xOC~ }^8cZV^J|e-%>3p7k!TQY.KZ,,ķ5ɐWfVB BfR%UmhFpV#8ewkTR^_A(%njx軙_VRб]u&k' TSQ-lokK[yvNh_|7Y{k/<:T흓5Zs=3 _tCv -gUjzmlBڪ+ 6m`b&]g?*ٟVdeVvd^/׋M=ߩ'Ce4 dx?ݪHlS2:ȟʩS-̖'^i +к`N'@_r2w"jm[%5E|)f%Nq`4-:>;K0,rJpZPq/1dfZyV]1`D愳-Fw{a$`Ndž;5?X\0cUcFX XV@j$^179 5A7eQ`҈E_$`^K9G=[ ΰ^>YvoyԳ?xW>E3Qz,o8wR~Ryؿ_hAт_t́j -!X{ViM_ jcoǡkE h!ݝ2v荚i䱬?WnU_a ^~C'=ިr1WæỨc(:^kO_ϴT;4$-;{-&z1o$<D<@Ӎ6cME(όbҌ%8Rkx/-[r*"N i鱭&Y#}M ɠv|tYǕFZAvBirv\z܎#ws{Ir ˖N iMXt59nATHZr}Ωos1`Fa 5XD" -#odNoMqQ_TO373Л<ffLI1ٶ nNϖc߉9v?2N?IsǙg=8sfDӢiľ !L> rCV|zU> Y`{zl;0G~aL4r%pˇ {>53MBް*9^_tqmqwډVkKWG-y𜑋|vnUG1U$g]B^kM8*)q Tq踦ǩ597z ;h/;k&ዘ s}jl(17=lI_z|'5O<_ _XYX^sv0'=R/KYw[yJvi؟8v΢qXlfusjnթQ.[׺`3\ ׃^uN7[Π֞#ށk*gX!b V ou]Cc}EK]\q'%nFncCr۱ݞ1hxL׈:qsXnò]~lT:˦|5[O]wM:o{ =ۜ&?mF)Nd0Ied{^ pn,O ®M͟}c veSqc.7!"BWvS)-![њrMS=#O<6XgWnS3C"QO8{!ږynJsչ4Fߪzܩ2㓌ْ3TUK ?GcwΘrP睪78$Wrb-2dUd$,g cyV*xLCrpE>iŃ/x{x~ RoӴG90|Yʸ7k]. 9}ͪc|]ց!JlڌmC9]ؔNOIC~ݮ~﹡/OoeP]a[_D@Osc)١WV--}(_rE)ˆ{LNTQ%s=go 4*epEt9:Ixu7n)~XVMO^7զo n Ƒ׼tv#]3% ZS̏4Fg5;<#ʻg3Rߺj_p970"VL]V5 .[ґ?w}a ;xwe#' tpbޮn8400K{r2.( u[ֆ+Y^Ƒ3owZ>׆cgh}1cM /n?ޒ1ZGc?mp]Go3)tdݸ]C[困4CQ 6ub57N{eW= XΊ-{R;-d]W7If|t28Mn`j^pvbulMXwelŶ3 7~Ʃw7&?k 3!i{f}N,#`b, fVj;xΪ<#.ZN BHC:]%1R\&h7`My@|ǻ^/E_-哹Ʊ7:.yt  Wew_/Wȃe~n'~z竖c|u?'~'rqo;8z~~"0>g 98"lҘ#/ 3XR&3FyerRau^[5n%z|Jp*2[q(d J/c_ymͯVKlg&w ㈖JZU5w\Q6^6jQݟ%unOw9*ylw\”p.cx7ؗ8ʾ2&iQs3.bӊ9Yym/k "i`n ]8y!&ep# X۹堑]v[צk㷇n>^7?w ~bf3oo*3Fs+"Km;ZJ/ 8"TZ gv9g? 8N>H]1Û bVC'KgԿ>= Uw2lEuVcѯU~1&R[\%\ )`iLpR(Fx~x*^ v^U;)7kfm{|`۷C;c{gxROÏ{kW&c8_{S!Gy .Y:y> >#~$3!eҥУ|\ KT1@KBOZcY8ɼ> [_v8-TI+k4\6q)O^hxr߭ٺms=1`̯$*faEdaSjk-܇Q\ $Pg`x_H,i7Pq #5&!{}%F,&y5p@Y98嗀Ө {Q2հ_ENp6Xpuí{q6nAMOhoz%4܋=NZ-X<~-khc1}TͯIx1iy/l_(]V2ݵOtx&cʷ|W ^zwGDpEͻs5{KH8nP$l[pɆad3ּyuم'k?2nQOϋK³XU0װ(sm5-rP7a-[՟uY%c,#7 PLls) :GsK(9UŁ֍=OEןU> <ٯ쁰NKYm69^v>c8c~:l6u9Ֆ?io7g4iGdp3ξ~nߺuηUӛG1k|n]qql|y0soi(oYZf9:B<T|{@́ȵcEZ`GjCNːc°L%Ǟ0Ins=$Q#v|%5W DGgϚdawbz!Coxn}m)ݷϵe-# ?9ľn[O>k'ցO`/c{FR8֌2T/sw'YKcXkػY)]!`s1c8,NIeq>OEޯ\aCpp'fZLq;שnNa3i9G? 7Y0˥rQZ]ZxMv=@+s}N;A<֞F㓃T-^}tݤ'@YܑՠWX{4E/qb\GhLe\" * 0/ܖG5+U՗Vó*S.%aڦbN!ǐ2wW%9DW NqK-L?E $qdzI]l2YK԰Ge٧h˻%n H~:/dWUgu20#픯nɵݵArU|glEۛ0S~X=2O-A#9;a%gV]S7m0wG*66?DJ_-be+9\r42&tg+J VTnرX{Sb Ƹ u?.믄au9$q 2Wo]=YֽbmݗMtnZNў 5"g҂aߕ4+ʵE7f\pr&Ǝo÷[vr{AeͼL"Q6~D߲^e בxFfuC&#f`ZueȪI+]?UӼfR'*9<{j\|ןte[6W'ȺQW2GAY!D_V\͔f4Y?0Z! ^pkS>`Km 0Fk=som5)r5]Gha+7ỉu,'<yOOoXv.K])_ё3ܹzOʶ'9+ifGe^e|/W-jC4ַv\[CNCi>ؓ³>X7uYWVk:XM5u=N!kr-o qw_9HȺWG_b{Ҿ2@S7YA̷ҶBA~0g_M7c{kidƊ exM(6>&jG6,Yg~[f6 2<) m R~)YSxr12jsC@wnøV?7߉?)Y1}{`ɼF~'$nnvMn1HofH3rbn!R 9[ƾf 5sOsvXLu9ðظ;.u571^#9bnK-=MSu&"|x_OX2X=%UV @,~F-j wMEa3E|[1׳Du:tzo+/yvU*WJnd}a7Wcz9PJ~ysv[>;?˹c? trIbd_+7F& ߃~Cp9\]XzhcSf+V\fC=|+|Dqu¥fN1#t{-qs)6;1ZɳsD s sD Ju.<;yuεa>KR|&VkxFnY_wWdZ͹½=9W_jpd~%'/[W3? EP9C 73Ϝ3.Lv^f]Vj6*ˑ@[%A>X`G lVpEk5FUX]uѭrm9\W^f.fܷv^og{[~.p{DØyuQLF./;s;3x='?]^0Ư0 lkc΁&wZ6^VD3 ڞBom}r=>k+-hR76]?{0:<Xx*,S2_.ocwa+k UTrϩE @ז:T4pO>诘|U`~|==TB; f`8hmpax9rY@<=k_nGoBZSO 9JυV - 7>{5qy (r6bC:Q?ו/ k8KLJN7^#&ɩ?sԶ-[-3`bB67X>1*B 'eĬ܊k؀`ƫ6z  ` &T0}K<-&vxWGDLGFldE | 70{3O^c߾ 8==N< 'ɧ2qho59NYi.iy+'-931?Ĵq[G3 Suב腼Ku+25'bi~P{ 8i```te?TRq骶:U{uk54#L?C|/`fT-19[ZkLFn7^-kg3R4Μ"R{˟eWxr|嘏NfvSqF۸n?x t~ %\o'tN^fm.4p`\9݈.'0§|mI6^EO wR69pƒeL^^eCK!944F̺1" >󺭴ՖbW6Vtpk]?c)Ul@djZ2m7]{02/ m8E $l~Ԛ_Ldnd]Qso5)ֱDm3;Wmޤ\j~]_aVqIWw\+.o1p!N tF#R+#Oq647zFm6 ,@=]vl}ӛ!4]umWUwvwG :AFG?F^IfNvMr?L0z4RZ+#ա# \D~h Uʚ-K?c'9ĸ?[_(C|%[xeSDj.ME3}%A)'{Gj9+us2wL>}ҷZdޱ'C=StMOf"{& D-ֈMW/&BCtcַ*\}Oj9]ijӭYKbWsоZ8S}-=dZzjݹHݏIWS:)?( 8vWh+VwSMnӪ*v8 dk{DDd8+v滨g R.5-+\sk<b'kª[ŭb*>]y Q`$OUPq].ĕ1)˹AWX`|}ss>imcZ0)DMRy*Ǖ3I2^Ȟh{zF\ ^X^}Mgh\NO \Ùވْ"['+3`Z+˧/ Mm=Âq8z?CV=?.RfofxokPϠ33Q?/asgᙅQ+OgͰn5q`Wv;ݍ?ɿϬ0s_:t!3*~,cb[q٬t.[##Ԭ\ɻyaZ\CCN( [MgۍA77c?ߌqZ&9^sN?[}4"JΩv79bIiB1/`@"[+?^±?޸NM7C0 ӿD^n|q=O $׌,b#Xe6޳Pm:-92[ L,-y/ kQ sV L7l1lC+w)t}Xc旇18Iu$m̩ѿaRWiݘ[{µBSZ9gbj 7^<)Ayow֗m+ݰZlӽ]U>8VW/ .ߠuԘgϟUX6TqbTQYx ̺ؔRdU>Xmf_\WksHԤ\ddrd )cB#=pK[{9EF;ngr8̬ K|&sx~p9h^㚊ϼ.+I8>cI]<.xN/a#j2[MN-NߋebNդѻ͋5?8'sn0y^T}0ȏc0ED7ד y˲1)ңٿ,IUKFNB fnP#Cx\[z/4er{SJ+@Ӌ|w7ߥOmS_4&Rpڏ֚E_Eo@`i`tjEwi]*Ny&g5[ }Z 0G2]n%WVy sXcYb܀כi"sM. ؟WCyU[W<ݍh^FtiY|˧~w<}[`R;:puz}[) OG~pt9كI3&wn9"U= j)z~ģCW&z1ߢμ_ìJQ ]s̀u&|qI͎u-S@u[Qf2zбk]9{[pm\ <6Wz{ʰduopz~8*h 6ُ>%GEXOi\=ur4!jj@ XI o5F #=rDmcѤsC #YȽ\կNs oh* k|O=ӻɼqrF͍naԆ=`s:=~?]R#>'b<׌hlfIt8_C0gfP| b/rWW1y .|Wo^<#<ފ!W6>IN9w<K~FS } 9@ߥd^#f7 T:GzW!v=|W`tÕnZr?*wEMvqis#j43{43G~Mgއae߆\>ӳ?}fbhGC'D^=#/}{?v~x;=|SBO;T&G?%8ڡ-u䛖JOhcL׬>mL%jOȜw.=)-uo9L8Vu1XI00+@6d3k;8?PGExS]OџS<žqҳYx5+^T?EP'-+ٛמhee1Sc.ΎM(SMj8C[hzo,<~c݁%k!QWרv/6^-g`BemA0m4p5cPi_9m$ڙ+$'!3`0 !@08X$Ğs[zn߾}s.R1h-jh[K79v<:+'hezv_?n׏?{1&p< ۋ4IoF< \x M}Hȶ~!ܛ\ f '!r' #o7>U1ճ#:IqG81;pE 8=针}iGZ%Vh._S]cpHVp^\E*׈!k:_9?8k…Ql6hռ̻>?Ko%+Uӹlnjh5i|)[a`ϡa4NB,0Tf{\'̛u]dЭLt%DMզ6@h#Gìu5ӾQ{ \̇B?d}J30Ges5VɩڥpվŘ5 XOtcXw^R,^˜(~s,8e[yĻ&jk \rµՁ;`3KA- ػHzn5rW:4Kɪ[>fimC};Sx ?}Y4 GT1䳛 #oYջj֋JyoDJ}3UNs/ΐobIc?e*Y ]]kXS1RUr5_a,xk&9#&N4+UdU-Gp\uU[O>cWs51 vX9E犸^" z2_&k˼s y'lzGE^M'Sp YލzVJ pj‰kËLIM P 4ġﶛlCYՌxڛ :d s7tcw U?;y?zõSUaO}3l <+Cutjiޕ~N=Káַ}csUtս^{"vH5oȍѤh%j^hWѸgH:{кmCE|>.]0G[cr~vu~L]NOk_/N%+{fA_XYcz/sP˨O]lUoVnyshI' R1L `M3N3p$GGKg3o|7&kԱ$:8,pn1m;99oħhNR͔͋"Ύx-xpO 3ҙ:MYg3*-s$: }Il+Hy}7P,^v.4>'szhqLGC ` $6u~mnW jvWcP[=#1Rg1O/;Rz.yþ8ᷥǕ#\>Qrm=خ6uw5HƳD)g?̧ċe~`'ճfCB]> . / e5xW׀ZקQóMzxNbu0GYzW=M5 AЏݓ(~|fX4˘0Y~FMx-y>!4D@?ccބCOn |"ϣ gj¹p@jY{~y7u/w)^%?mjSl7>iDR,߶EZ{>!9ʓ#D]eZʟGqhrlgZyrw4ɇ~DžZcW\b֔/2]x< ǡPI1E!=As)WE Yu.9-z07}k=953owq2")3-?:My Nx~+@U'H$4R@x Z 5q{ɛ5~$gҹeҼJ_iԇЊߒb9 /̽{[k^"w˜u/eޝ6E ur?C9'/4*O#?s϶eb{Umb^ηeM[x=fK5`ivm%|gn=hg_to;Цwk=Msm׀w67hK֓4=úZ֡0Tofكez#4բw6"n޿ncr5`P}ݼ5+uitePSYku݇y%I۫r#_`OoVrJN{rfKknC|zxX7(0FKԢ=yS]F;BU X5xvr?(/wq'WhlF'&rhit;Mqˮ\3{4¢[g.sgJGj|r%mwHY}o;Gg!P{ƭ1ߧw# *Oj$l例as7)LB[>KV˵[{A\Z*VjMg9=&_/_Qq|rvoE:2ANȡ:צknӚX1ƾpBso)PwȣZ̤X;W{S͐5LZ֍Fa4F߿.(; 9d|-Ә=rj>ivWbjNà*];OB?uSNu/7~k7~TOQyxyzfSog mKE6aC [%Y^npʨ T/Pboz)kʿEi<5΢ 8sLk'ȭՠ`ճWŽMcߋd^ģGq_|QJg5Ξ<Ӻ0m0qlG8ޯsq#qi{4Ǣn.MYsw( T@XQ46q2cmX61-qNfaݰnY˿tEkDRKS.Smx)x{֣x8'cL*4&ϺZ.[ "(K[XXsbR&a-XK̥El\c]/<kܳ?kc#OI4vy[b {f-&DtO!O~Mm;?w}~;hѽq.so9attu9&^Oߓo2耯IGO[͡Ydεro3+WP̊:.|bT<#-[_c+Փ46b {*g*x}:i agwVqin6Z/sga}K螮!ϟ#ӷdOng~Y_cS_Ub 0y=l:6!ԝ+JS|s3)恏4bFƙ )TO׽ʷTxWml&ُyֈ',rU*S7I'k53Osj[fy[͹eso' N۵V46e!&WqL8tH8 amB:֜x7Xw']ƬQDyr5ܼ56`"xZM9ZlpOLtitMk= tJB{4>هI\uZuaڲVc?79ѕl*<3&(SH&题I4 R.?'8!]>v̞Iyʷ'w,uѢ|{kYpN]KsYoWfaT_Sw%}2 7g0#q1s};IMg;†F}"n~)Yrw ќe9Y{b\`֓>bR=mmC[q1M!\s"Ckc_G-&kGҘj:Gzk pYe>2Xc E#"_ZTxs `OW~DM;QA@rQÞ^^a|Qt#Cq) ^(~kgR/QO07d񰘂 Z̭EriS+`\-hZk gWs} }@u%o@K7@׾I;[a/u<꯾`2uJ<׾}ϖkGc x(KoSz+ԴiԨ ht4s*]~úW;V={O8oQmr٠,:Կv٪-ȚGP_\t;em9 :hp!͑W{,d{~?| {Y)0>ҡ]%D-^A]ΰ8x:8&sJ_m9 { gg]k>iN5RɃ0e>͞ Ǣx7'CkYү Kńp:ڢqpy\7>g&m=2 s|MsW=0G_0)N$v=;Z4ksa&tʥ^_?MK5zxU[ xlhF#\Pn Ԡx¡d^ ?D~Eu-]CA<>;eםFr?"'>Izelln%K| $ܯgU(E~}G 9Ft;Sh\hn9e.ufFTൖaHSvL;/'F,\u[p?wpƀ}Gf+Jq Gh-()_q^d_3g(ײB9Ig{ԇp:> ѴN ^58<+Ww^C|a%Ə/Y]Q4_5~>35iW8O羹ڳZ|+_+zaT/Tgc.GހXדjyمjk;wmld]T+75)G[s=+}َpQXg>y\%Z=-}켳j\uY6MvHa5|zS_z{.߯z+]xO?Z}f7I0v{~'Y&E|H_/RnqӾKs quL(E8g0NNt++'e6W,S>0?7aaxZ+4FAz+C܆-6qגou@wuҷը][Z4mdld9xFT]Y]z*E8=+ݳʿB_ɗٿփT8YauzF:3==c t[ xT()W 팸vK˓ Bb^=ovGz$ N0|Y=sVS]qO;`Η_£Ng;c.yΗ5YsPϣ^7nFT=WaT%wF7Q&=˻GA?F>s_pOo;G}Y/vxj_ŶtiXS gŚl66w'z9qr8Zf](x&(uO=Cjg#5{⃖7-#Ns^MxON;wfW]}mi㙂1s&gx0%gKlerĢexkchn?m/Fs#.>>rnH<\.(pF&-B*VWD-{כ篢Q /vMbAq& G<&VyXΓfsǺd?UŌ\ 'ANdt7fb =A 3犇Ba*>52 Uiݢ$MtӠ|&Zge37<XLsfʓeq>=+)Px(<0kP sp{Ll⇓  )C:8$()϶'*uXҒ8hxx꨻Y&T֓jV虦WJ G擵{еA&ߩ~" ͒CO_͢HEߕ]"`hq*XH~h0[wMߛǠ%Fųꋦic*pK% V(&aPqϒsvI.ދjg~n5jWkLaۺA|(rq>5\5nn,ZG9&5bWh[cu-o5mxk0qѬfG~k Sw w2w[;|5>\Jჰ{D= -IO|^m8KnLqp|j|.<˜_im2tR s8Gų~ηX_ටZ/WopW}P)׈3 gxb;87|C[anp_:7#mS+MR+m5ք2 k1sʆ2# 0Jns-z.Lz.J?xy=Ϻ[Kx_ y'0?dokaT^ȷ" ^#by "x~}3k@&DS.lp 3Wvc=GB>ԷL|It9[^8\id?`|^!~]{ŗ+/80h=8˝sUßџCz3{G:^IzG L 5=U/\x悞¬9ū>7ёb}#nLMNz |p½MpRAPPb)N͆+sׇ KcGe oä!crnh3LJOP8u^K>\_!U:Zu@>  pɣp^J>!qmG{-.\ Z+k(+< qMpnzh"uP oPs*MBJ8֓aG;D=s/^  b,~n1>lOkS;đT{Fk,Bғ@ [aK~&CrjQN̂\oV;d^uy sc4+QѢnNڭ;Au ~Qmq JxZGfjbTS睚Чn. QϕJϞQjv~/JbOXmFOCBOڧb_.]S=;{~UKEiHxGC ~EcSw^7V{,z-h~k.vFeOj,o7} y<0p_ xS=O}y0GzU 'kn3CzmK-( X垝9w4.?u` xnds)dgjnUK5+fhV8P/ ɃQz"gY(Kin}G+ li V--APkסF^/~r[{ZH D7VΌfi=e4@"x/zjk╸6}!g|X{:5n)wlNvmQ<5s8~= 5M~\{MH?UA:Ow= c$Ͼ]9ɢё'r9wF1/YǕõ'[ɼUhD5KkJgzM'EӦTfbNM~ \}MG۰ ? DF/TyoTųwСo6A$/leGJ/_9TA@œ<{sr ,ZZ9ĘP+h8T4û ;KwL#Bԫ#6udmR{UѸ[U}Κ9?YdY ϒYk~K?fLWt/o[ZYGƻCA;}/J_j16󡧽"gywwg3Z*u(@L_ue}=R_kWqwmX WR߰?j/}e>}(wgGs<+=pbT|OO]n)~ާb]Ŝ}}ٳPk+6L m+-O䰾SהgM7ttɢt, c8қl:5܊Ѝv⻷A?| rPoaF{Ń(Ѿ/{Wjڀ_so9WeaxJ_gjZ:ɢGͮ/9#jvxƵNrtΪ{Ҽ~=ɝj[nۺ܇tMlhmDLodfO-9k|DՄ 7#\S\ [ƣՏ}u1b SwUhVvysr'~*J3&op_w>dK*\+jܳᛞprCBc =r+YCov\o9g·h+O׻O86ތx{>~kCy]h0>o`"ܛXg4yBፖoZmX_`1="v\K7Hor\)&3W3;5hv^U>g6]}O]rpۗX.Ecp\oΔ1w܃W [nq5N]5ז{jlDvt5hYK-rt]6plͬ׏AcPl79nrM?fg7ŋtQy(02L}h1NQ_8筼u=~K̺vƎ@~}X`54zBi޶9&l۶|| Cܺ>=VjWkע ٘:9-w9wO^ḌUpm`U8X9^Hs!><[mя%i{fE~;f~spuyO;fgl[/5'- $ou. I|~ bٚ=ge/D빢 qgCNoUz@ 1pF|m_ܟ~z*$Q(u* 2^C@.ht^J4+3Ո ѥ ;JѡwH?{ VDAֳ^yK<݂Wnk"p1ıq8xA[hh>=R*<8 }wChv,!K?g7dq u}Hb:: ]hR@}J>d:Sa;sJ8_zW}[+͘%uJx9~}FƑ+# '{Sya^Ⱦu~~e@ i9ϭ֗e_kd}SS Uc,{wDn8lC>WqX։rT=G{rZ^4A>mbZHy:m#+cnNҗNok7ƽ6q%f-y#w*{J|8yuJ;y=ML=^Ϛˊ75H;415El;F]n9V&5z>8l k5ECޣ~޹-A=SO~obrXAk{agZ[z3OY<}]|We&=ѓu)ߑ;w]Z\F7UݣfRy}o߃N}-+QhAYyr8$x?xI.KgIX8O9Z,kBrk|0hhhz^;ntFt3}o0S0IL![YW&㻉f_1p?:781}ahG@VЍ6x=Q]ikWM&ij˙0 $1(؀1a;'xKts.qH>ߥ|KX|a!qaѡ3)KM҅gYWSPr#U4k% ]/ mXhz9~YYrü׹_Y׼~%U{[ b܁?,x[ LM FRn;7™Cή^v4~+zg57T{ڗϥ+G/9ʬ&V?Wv:co s.d@6Hns3b>KgaMqճ(s]v.uP’twN=W~{T/C5);Ir߷ #B֩sZ/9&'k3ufƇnZpz0ܗZG߁׸zc,e72g̅\%/_ Msh#0==[<<9+|#Z=jxF;]$l|NWRʿOo $ $ʻpVaCBE]N^oiV 1OP?1g˪*hm@S3̜8gÌ6욽H{3{}]Ԭ삚p&jήh}r3%n ^kg?k;\/Ljzc>T?RC_g$U]ǗȯaU_q5}Z=4b'8k[iÌ&+˒u)&?pK+߳{qvɓ=܋.Y-~u5]s Bm}Zuz14ljBǵ{%w|gKw޻$ofxf~f|dsI$?Kf"ޝ[\;uqCm;|oZ < 9DOERфEfܕKMiq^ޛyxu=k;[f<S+84ݎ$6W@4Lm-PK7GxI%jbS3}從uE|uӸD$Nؑ@\` W@HaZk?7pkGqwnÜ ?]4.Pmҿ#%O=|Uë*tyϱ[6Nߟ&2*=$^g^劣n \rv̓6?Eoѓx9/_OW!Ǖ4omn^W`f{x ;!0.6Xl)^pl^s0Ƚ'#~TC'Ӥ3ΕKi#6'rD8ts9g57j'`Ϙ4*=cjդMܧgXU\hޛN 0lmҰBֱ>;0ϬjA,O-7-=9}܋Vl#^&|%Pۓv2B/~˸nzQvp?'ܷ~Ry7F GW<eѣ M4/0yp^|͠ ̄^;1(8-ܲqR/GKz!5.L1J5o=LX{Oup_y4nδB-Y2oמNwF~U:m\1p:M0rt5h>Ày5C~.Uβފ/xUi|3l~ QPoBjw>Owٶ< O哻󯟲K d=S5c1׎I{U=z_okXd®Tsfc8Zmak.bqŊu)MNfpkcs3S ~Z7y=ձen lͻm@/.ԍG 52ŜuAR**l*fe)-Y1^яWڗnʢ3 }^i6QOM/L9kR3nuϽUs"Ǻz 'NN=jQ"cuo`C|QmݫT=2 ^e_U#_oVml>46@qcI@ԇ+qzTZwr :\3KyUmߎk $سGfdI.ua:' ǎA|iW[f:g_ o܎ussY/>#kዃG鮙]k=ca57䝮Kҽ}(]'n]e/mj!=FΧ̷;iTNfPj|>o*e7cnx-/ݼS8; tzyj|4;yϲчxq*^d^|>=`Rv@*7/ȵ@BK q3ze@ˊ^@Neʔs7n3ӭ/:?;u2Ԕ}r螾S>9+ZO>&^@Cq6}ؗFXn\7qsv<@ypʕHok-v_І=}xXw{n,qhu<;ۛ2Re WUZmp8Gn /YMr{:^g~;0ϋ;܎ꇻ7۠4k8*+^=:R_08]}wJG{xuڴWj8?kzѺPׅ 3`:9drI=e92n5Ͼ_vݸoI8> ǥvwas8Nf /2~oFJoE)bUj ^v,6#^} mt3Pd]@cr&5M4&国Gk+r$וybc2ٔ'ʌX,kO\ 1p;ũ̥Nˬ۪镞xehG /KPVgCdt\UM魶K_?g]IvTe q#og:yXetb?l+osZGRS{GW5t̳}ww-{)[mtŘJFOknֱB$AOPe!־+R=anLOOuuՃVT?ԧb7ǵ&c-FSI*wJ̬{ɳd;ŨS-W9j p-| 4{&mc5FAWM+Wt7>od04z-&TFoAq{E]'՛P~2_F?PjT˹tyo\: OMNy:E,dybT>C|#XXWk=Xm![^ꯀ۪z>BM'0=|oBs(|,u;0tC]bX`w:<rߐ.\Ps׶ϾNB,A ln׫I~ JbysZ}Jqm)\W^dʳl]}:۝}(Vu< Bݜ|2x]'#Nƾ϶>Q=cxE~/z1Kmm>6痪UynQ$~RYoįy%^x4{9f]){0kG3>Ii~R?I{A^=ι.jPK{?⧾ d݋T{C͓s`A5!/ [χ> ĩv@NJ0fwy [Nt]}y_bMreԙү5пA>KW~Ȯ>=?zŵwu~~K49J?֑Oh&|yQPR&,mdx.Zڥzo 3o Z4WXԇ-5ʾT٦YCu.M['e_2qoۨ6I|1/4لrԧ_xg*5; Ćlj狤 n U LӇ/E!nc&&8,.zFA5ٵotoS-?t81nWq7x}~:jX|Zz/f}?&XJS`zǕŶV?IOX {.ep/v+`lm/WrԒ` |*^QA; g] Dž9o5Ϯ9!lqQG'-ZH>À>6͵J3jWt]RJsb|\3Sen}'Z_ӧ\o w7_0Pt*=G>!N)M~nvNn?/*[7`摗l?˞uͺoNs+i2~Hf_i=yOEy2d'~}gvKyEzV{.9X L_xf>߀+&ͅ& x0Xj.>X Vuž5/w)  bD] \T灛Gsip)q֎+8P4ʃ,4h49&_gO1G^3&_&;Ƙ렓 p끏~O[X7FR=C] ^ˤS$= ucy/.wo1OL{Yz"HE GJ@DM wO"o,ONփ&;@?Z\oyn[Ou_EVw~KLS1jxh܁r XE}꓃@s45XC~[MDw܎ KOwGz}A=RuqCxp|Y I|c67y qTשNltx,kzJ;ԁҗ7#<Wq×^TkЗRn[zyQ }am4nxr]{^=٩zPnF,vW_NYo?V_ϛ$='8^(ߡf8g|5tUh,ƐX,kiȾ^zVo{rp}_fKּs$[I~8+_%kd]5ߦϲt<e|W֜8rFv ke5[mhoٗ~wEcN`2hXixV컏yMzz,pwsbqzRCr;wܖ~6+;!V-Qֿ^=,G?g/G6? #.WoߋvwGۊyz( [{ԺaL=$f&lٲwh=CNqf#8N9N>R^O?mXv^S3c}Gg~i uj]Uܔx=fB-  j9:OnksVkE6MrFn_ek7߾ܵ=m^e3yd_f+lno~|n.~_͋z_<4*ylΉ/ 9Xj,^L }\ ԘPTFsugζOp.ΰșṜ:sFpۘ|m1sr**\nxc򞹑(Է&Ż7W5C?·q0$>S],w8yםø4_O%#q{T6(!ૠsV:)eK|]kLOux?|ظC@g{=[|oMvm|<sj\ yej+ۙ|׈~?Cl{*WR_ƘG_<ȶ1DZYh$*Xyjɐ]Y>CF@07 c 6Z0fΣ~lȅ46Xcs<' p`'ur\FsWKgy| d4bM劮p>1kc~yyWs( #l!Vg&;~N+mGrc]lJlY [5!s o[A{vF#ZΞ'1v&Œ"9R想FB^&_B~2;ȥ«[dց2˳Igo55w9GC~q<{}|6,9iV&QWlr]3Nk?أ#_p|#rdʇ z:؟sKK}n0#->~#ΗYܻn1q#Ĝ3ƂpVTeb}>;iWKę% :2O\mye}w94$:vħ`:Æ'=wҞ#k螰.niY-<=׎\K:|gv\yX~\?xuoWk%*RѧowU HpIN\[[<-j+w֤T=13|̡d}_m~_E_`UEW0o}+x|i\/ylZp S,͏Ҷec2+Ԁ<-Ykӏ3R{lσGqԹY\Hc_E̥}1Ɵ(`=@2(NPyKR  ?I>pFhzfm]8V;i7l)'TyԍC`leH(?+co?I=*wzGu6m$}|J|N\I;Qɂ oJ| _`YuNOOȻI.}*=b#wv7|a!Fˉ~ꧢ3>}u>N9#mzzc ^?+GƑx=_S΍xUCfQ}6McqQ)?'9? U]._Z9"5{?Ui).ԗؗ#v09CZS/S'TyCLE[N ɿ'j-x+{*垽Wjbׅ-=5F]=g~rǕbwm_o{`.2p a^c:yNtVzN*ҋtR1gE6)N_d5y۫lND{?͡VjgΞW ̱zHxG\|xys!g>$%L搱g(w9op^Eµ<^tGwsM7p@w=bo^̛` !WOw#k$Xڢ45 \?抵\ ܢFzo1^3RwqC`Exv=o~4xóܙn#a@7~#U)|XlSb8}`~DLL}꽤N=:{vRKz{o+ޢ^#d}m(83>47Jtv=zmW' j/ݗqv !91zr7-9[ }ąw>G#5vr!W٭T 5q;]F㾙Fwxk6<%>V9l#ћlu s?D ZDr\Q#wm}ӗkiȼt[*g}kO|`aSW#*~kk/7bW sYOψ=r]*v p'}\O9sv3ScGϾP|hJQ^^H` W}1 +@<®*~NsD=3.Ї^}r,6ZpZGxMĹlGw=r{h9{9V9ah{-}^j|Z1[UD|3֨} Ftڄ^*.^ӹw~t-LJKbyDܖR[T-)eRכڐg/5n N=G}/wW=ئFUR}%إD5?=ҋGcC\c [u;^ބx!2Rk}6<ݫz3j ژZߠw 6o{]$urF? emRg "קӚWA7%1vzaKc&xoE{@,Fw}`/As}>G1Qu.c6<64{.| _l}zP4k!QIL^ݖuvZ_+|U.<V,xwzoSt|tv]:.I"ٯqqTql=E6^Wjs={;֭s?Dz+EO9U4Ӻ}An{vLyA쬉r'SYr3܊N$<Ǒ#~X?0`gDϦCG:׏;Y!QȪʪ̌/;B\5 o`CvWR;犏EYFd~)/9KK`Cs=idݕ-# &=dyƟ نVRײ:ݗ -Ǥ:X u0vtV[w8/Zw, :#XZga KdԇX'n3yUN{7TǾ׼B}~[ME=~hr{^ޭ8 ]cԾbpZyg}=+XYh09l ^3w)sXfՌ3._:F5uLc?wĚ'1"ټ=5~-TGt/tT@-Żkr?X?xX t'EAjXw*'jDz?ɏߙͽ:]\m||LNґScD0Tm악S?1VVx1`ZNOlMG3v7cFz cܳ'>/.̹=tU9c3RK9>{L|\N*^(M`EׯcB6Si+zϚR0/`*5k`ֽ1N%F%.CSpK7#ނ$k RٓFyęn61T<΁ߎ7U SHhwAOvE>KsD\;Ôt3bq-Ŝ70Ʋx Mc6c|h6.|}l|5[W/~|%up.ΔV]?*ToNXg=y|ue>W-u\ُ~/8aE%hrLi^p=M%OUx">{.Gu$s?i~W܉`zG1o#΀Dmp9pJu#yF̵V嵛ޕFJxën" Bܹ3 Mg7SQSa΁; $:C@Rb_\l= t0/oZfc~}jswo.D3|>x0~T#a};ʹ/ųN FJ+`Wq:꜡&؝qQmsjUY}qu.&{ݎlЧŒC߅YC_ⲷQ71U4B뎪׮=V02׮7?15M;ųN1zo䏣e/,L{58Mׇo_s_c^^of!59t='aS*JRٚNfkq $aSg>™.KwE*e` <60KDOћ2K9E WmRUi7,|xM̥@m $|_mo^r|3©yH܉hl@l0iX0sܵ)sHkg½"nX_y*!h1p%94FQ쓴kç CYJZOE+fZ94a;[U܁i˽,F[E=Ѥ7އFx8F-&ϳV]tK{D=&l  7:\ <E_U?LK: iN^GMhBk" 񾌠A bуzcΑ5#h9KEvwMO.x=ֽ_:I?ԩ"I0^{`~⽎[nGwԻS8v-7`M{D6YIif'VF|pÜܪ@mgM/v(>e| cG?팆v`L6'MizI>jMъvc&O3dσqzܼ sx7{\ myV~ sfn836%լ2vJ7/9%of:9kȜcҽ; ˌ3kx{pY@l0<[XCjڇgu]>ˡ}wO݊(oR(x[47:TqsJ)i|7~+ ?k9pv>k2~Ę3KYĚPxRڧss$.] #뜀6K 2ߨ[Aj`z{:gSiyJb|^C~w{=~yu&z;~Aryse}oQΜg ɇN& )cGɣ/έG":7[ KuUyWߣwq3=~k!]>ZcyͣB8V,g0|2ޟ i=K`Vk0X؁ l;Y4a *cCbl܋}^ȫ\q iYj6*Y27U9)3#[S6[ܗ5!,| g]do숽 +Om?}'˴u#@,@`ElulY0'ۄNTXv {ӓxÏ<>u0k/M|m`^yhEڹxn= m̏][٥Q?ejz1_3'=_Z!kV<ܷ- h?GlRF/wu܃NScÅYcìmské^J}o}<պ~7/Ru'"OQ010G+l?FmF VshJkM7e>-6j5ZAc|.; w'NeNzRk ]= ϓs(Ct8[Q4`&NvlYTvWYz ^$9璮D?G?y:v4#:-渂/AG)yM_0<,|pwA P6 e°rڊ=}s]$⿅Cpǟ7❍=Qa -.[s"1|(RjG1ܷ3_Zr)VԃQKca'<^[mCgqӓNd~5b8)?xu _u^.ܣ.ۛm0L%oeEg,ov.zDFsT})^˸X{F eem3 ]ʋ^=^ꑇ,uPP{>jOʒ6U]spo# .+u~?:WROx><:Kꡟ0GgvP8 kK7UM]%rn g}^+4on,Ą~Ϸr\/{jἶu~\yZmniuyP<[v%yɺʹ)]lIR ,n@x9 ߔ!Jn T޲xwtۘ諚N5r(F\ݦh -T&q.>s^]h(zK0Xfzf!3Jǻ˙/>qLE(LE m&zOOD'Q'{Q3WI7T8D"9Eq-Sя<>'( ujO0Ox'͚7p~ l4~ݩ*JS<,tzM[epT?{b]PWJ)K&gp3$Xc`=PyshZ<8mCC^9ms^Pc,noǹ楃blz|h_Q>scS>9{8N&zt>ÌwkY7oWޣ r^ǛyDCeĸRWcǽceК2dn^$?k=ԇhO"y_9W[2k͢"y%w(Q"WVq( 22b4% j>#;}u(C?$û!J߹&U`*f+^Ua(}˘(hzX c!Oz +h>l\|Esۗ\+51wqxӟ_vvWdn0.e^46K6jvmtimM{z7۞rX#):kǭ0mƲC +']:Y^zpZDk[c}{ǣ1)a]BoC6wqgdM/sW}*t_J ޝs&Sk /,&s~/9QFM(Uށ36o3P}l0Żѧg)XsLH,o8l᯶}=b,0K2?>?k?x99q1ډxƥ;G '{{=X357+i&}'4O#kJ%?dm}⽞σf\TjzM!cB [7AMNJ_fRMŵ{<^SgMeB"1pMx7鷥\9.]ux+ ښ)&:,yio"񂜈o^ѧj&2C3xpmfr0ÙLA][#EK$uf  D!㌍"O> 7rT.kZ^bޘkX~`Q4B}Lr0/DoY g.yh,or__Ա@87RA8T7иi6mEAgG߉)gS[rP,-j`au.e=Jb- %כVp_NSnG}F_ R3uc\{BSN>+݇р5`4SzŨ3XzzE{^;vM.3 yF:c9Q4ڞ TΕُ[`15 '^X9Ei>Y/T2VjuǺ9>jNDC9 K+.{ZGi ,po<^ /q> U`T#Ys#똧 ?7 SCiޘAoxܣ7mְ5I::Ž68&NxJyCƎ,\`?sUb}BԮK䞲F֮`Wߪe_??azl~ƇÓҺ:.OtX-1OX]&{$vX)gAШ֎̥:,1j鉚>\x g2nM\lWQ1n1 qV7>`U;m!m F~,.+=/vWpp|DugD?zz;}?͏I\-eCOa.AoQbioOCh_<'}j1g58:S8Z3v/+гPK.ǍF@p17? =y0*CDO_ZCgr@AcB+8 ~xsz.^odzY O<ѵث" l- XXq ybuu5v rWf8~[ī>#zJ/2nz{ٻ)m"o#$Ʋ`QLjÂmV*m7D;b]uܝ"7BGZԒEЌ&5.ڻwN͸{gj4iS 2}ЫvvPmЗmh`]W.ujRd]j|'_ERUjʴWկT$*\YEOgY'+oEһq 'b6Ǽٯ,in1cV s52]զQm8kf?VmQ/2Y$Һ/քv_lVwzxevx֑oXebc{w|o3GpV)|Lmv$߄5ˠ:>R+[L?5i+/׮`Xy 2p4` 1Zi9ZĖbk8V7 1y4Q6ʴxV#0}xE~oCAC.D# ^"粕ؘ&7F2+-,\Іjٍ(H01Χ9/ /3b̓%}h/&њҥV»ٓRZ/6,PFͅSm36%.@Lƹl]4@熱Yx7#o"}rzY-9ڰpFCZ,-[yhࢱ[C9O'J x&k0ku`. :J0hqj5.}(xXmU1m5iCy}6l{CX M6/ҭSkTRc12Q7\wϪ7ָ`F헪gXښb=fm[Ħ3a3u;q/??fN%" r`cBb-f#R=?DbH:7 ?,/c R+Ib˼;ԺT:Pkԭ: `@ͭNMXJcJ U͉{˾SR %6u:j" U} $ÙJQv7Xv89؛*}{{'1?H੺u2Ypy7 hȮ#ճ[w/XOwUZQ/KKϫqV-ojzq\Q=6*,u>&;‡X?z摬ɟ Ϟu$k:O;WUC7{q@aKSw N#ܣR{Kf4jKu_G:Qp;mZ'`2gʇC2^"h`WỢ`o-vbEregБL'y<O ߑE<D| Ϛ ?yQy1Ua(|b3lҒ1VkoOo)Ěxo/:ǞL / ?>ɵV瘾z>y=ouOuFA>)}8,C>yR9Zx7~7 :mnbm_H9{x-wyl_]?}G;^aHY/I5ȼT뎘)rL[e?;F+_~+ c]yQl+pʬso:_(?-22.p>Mz 17O>7na݁f"zmp&4j&j=~`C}8Cԫ.֕a7vn1;zBpcfZx_+wal0ꥥVcggUXz|uk6b7θe>ϡҘuwLjTڻ2YoPuxѝv`ӛ#G jBj-Ϥ|+5; F\{-zk|oW)<W],?z OhyYMyV}qj5wpӸkgRFRo ѻ+}l.1zO 9LU.6#TTQ/܋OI|{goO_#,8=؃ &G~c[a%rNɲd?Lqқ%[Y`C!|XM[ũN '(l&kn~%ă'&$L1b2x_GsnO5oX71N<,'{ҟO6Fǽ>wv}GiR+EsWk9 }\1S|lG=bb:hrQشɓ-9mvJǴo {~[<Z-#6܏ yqV޹hy=ST#?P?ND1Aީ 3NZ)"ދ>줗{L[u;[b`\g.fGTBo0.<ε_4V^ܜjaQ5w|A,L;h)DP:wt2s>۬Q3W-ћѬC`oǕ73ug!#֢{ʋH-gγ V Ny{߽K/yz=`Yk{eL%GoIq_ʃ\y1+ڸ:r0Lb[gEš7-99~:<+Ljq`|_b̚f=olʘ^z1}9O&XkƓ̽1] *Vr8`%%} ZgȰELȃc6Q#ȗ{1.ɝ:z L a1};HGIANco$ܚ8NJhB'+z`;?@yl#q?voqObnFbœOyO'h2F_ߥ`tQy29WB/W3a9w+q [ۤz3t-hC'@p^RC׍e\ to,cm#j8sb}:c3oXk2Z̕nb†[ oE~uE0+Dw2J÷:11|$g{ $6\ v?[oI>l|ӽw~ͷͫ,F*@/w rSZ&G?CwVZ3X:^X78]K1w5o`Yd1[k͐wWp|Omඍ{/E># zuzCy+ Y StӻJot|O7v~˖ւ$4t1ܵonqonuvwU7\oa i#va}ih\vdqFg7[5{?&xmIN")yhM~%*Hv/+ އ}JdӅ%]\/≚z®uuxLj;}ja)oȅVw髡K)׮Gq8ql17±{'#[3N~@уa6s\\_C}u扁3NC\'sލ{Ք}~WS-bf. a>j6óf o1?0&jL?Iy{m bOqV a=yB  .m{sj`upowzב#G g1kG//&E@Nz}=Ƃqt#8ŪW55tO`q}ccpmCw)[E&r֧W\cf}pO.Ӯ-=3]ϕ:g=zeҾVU8j& f%qVpXތBϡ3A/Aq˕̚*e-.)E^]F__&l@'B3Q|vVĽ=~Ws=K:eϋ/*}~7lo.1Wn挅ʜYĚXs5r~>>3#fB9^58wr8WL߬oc( 31>/ YR6+ҁCqdEc:&XR'Ợ߳2EPXU";[f1 qf!L $ao8(}_Q#<'?cۑOC \E?^|#6 | 3< h<"@G<'88J|E+HnzT#`k >Mk A޸[zfyƂ9%;i{u#uF^G5y-bj]#ȡ WJ\|O1|1'YAC&l-pF.xLP9FZrjaS=bOqS#8!`k9&l۫ߏSZi,u:Cjuoʳ8`nW-s;y{Iv9Щ#.ORpTaOSz<}th V|KxhT~Ny<6 rR>ք:s^, 2b[^-n-d?tBZΨ6|ʩg;ޡl=meI3v`h`:z7rZ_M,<-T ;RgW\'{u7HfgJ!?F=ig[="?]SȽ2ww; m,pjے+k]y=^?M > O%$qGqo+c#w$ԟLv/ }N ;f8 ^9C{SbT< >Qkw g__>L z0_W< G6oN9tl1ׂB\J`GL{V Rb3y{gT2ĸ@Ɛ 3J\{{GmmsE%0WS 8}*X9-܌5$=q>t|Gџփ_\*1! '&O _b^Kn;t >p 8޴?IʏEmcXrI,:7|TO ڵI~;`R/-\\<A5.qG 4`S9iT!]㼵F+6v=:s/QC_ɻÌE`>ca)jsh_1äbC-S}{쟱?}fn9&L7oz[ .ss"fCaF9c=*\TbL~=/YQ{k'3gܞqQ8G>e ,|]Ae_ {u.sST}YRGܕZ3-Wf̭3s_$D=_~RHFcܶD0&{g$!- !RbK @r db5ΚZ } ~h)J\+ Ȋӓ.Xm G AUK0)V#(|q3r!9 t'@ n$>J2T=ޅ6LwD"N[]ՁK9y5laW^?ܬ#}~Ieꀲ|1Ջy>VXg9>iCWVң\J=y?ҙWngA;e>:?dXKP֔d昮\|SљW9 He2%'- Os1Cˢ=5Š2e /D/wq( z2G_LB Mt!H^8CəeUt5u6 -!կ9 C2Pu>y\=cJxOXvΥ09R5程=JS#MNPϹoO>}OVlJƟ7tRXjc\+(h? ~uѻ8ݐ=8Orl?O\e]آu8vfOl[/O}Iq&%i uG=oem꟎o#ɾY'qZsQmƞv7\Ybvx>a߾¯݇c:|Ȇ`N 731B\I\ط]+_~h0K4/JȖ`:;|}wA~-_slR&&Ψb/#+d쟵)&kL^g{!Ȇ;ܸwĆvWT?;ڹ蒘ic|]b^}e%.H1^¦*$.ՙ^>;97w@芍bu[f+Ffr)}kwe1@YJ?ٽ-3Wۓqʵw_m^z6;0yO/?uO|c+΋Xan}<wM\K<:WQbKNͻ[ɭ/yɈR{s{N] c0Sv&NcbOiѡtnҩAO_sIh}fLc10o^?&b?7~<^}H҃ ߿1Gǭ;fNf2䍡v|v=s3NId<㾘[ff=Lx?23A1,בW?xGTR%۫t6JUGUot=AׅԅEF}<4xqLfKq"2OmRsL,l<67b6<8qUg-ycŒxZJ)B2ެou?q#aN|c9չs3hvc2H̛ܞ77aWԽ.4ɀi7T*H )@Hs1}(n~^!"OR7w#돧<0\>Ax1Յ_26a63 Knc+읂\95Ԉd~%.?L!WG˔qبE'8m9W` _?f_0w;bp ǒ7HҖ!21<LփD؀us Y,6#Fȗ ,Ck'>kc^>)".`8Q>Yˋ_d= |szO@|;J +2Bab,)moFV/+461#iғfS{d65uEywD4O6|ˆ= >9m 5k7@c= 횈׆}Q8xUv笕gmdߙE"$2~œ{c)}>3YdFJcw&b ~S k_SS|'󹧨GIp{m%~sHW{ET ̤ڧab?cǷbb1S̠˷l@ukRn҉!,`:]Tpk n{*pGn-H޲i޹2 g0iAۃ\W1 >t:ޅW1>ٳ^σynVKmYԅ,u~] (;~)Qs9Sx'"_1KhS,6$GeűO}Zo-.TܶCjks"Dn"M8r~, P }\?Ky.3lpCƉp-?KnZ>59W@78@ETrܗ9Pi>9NsN8;}_8ߘ e=+ޅ% "/w6/R_/'͗|1kbu5hyoy]3a⻺P5jeRug|>E^Ȟ'ElÜ3ytqu f=78Rj엃x|÷-OKUl;`ƦOqFk!<7b_X_8tZYN!,hΓ"_ii㙇vtb9T8br9wp 59vȚn3E h9̻QS.yj-u]8_#~m|0vr)\|r v]]$ ZYv*1rglHPqhٛ=;ČOӪC_y=w,֯MmAɚr; Z=Ru,XC3+'^G&KN|9xGb?q-^ /.1S/_LQ'o1vfIx:rW7Y7gNsrݴ y0 ;Ƃ6|^xzCD6*3=pWGbŻ鵴X̂r &yLD_pn7􅍙W0c0'ap _>c5dZG=2.:ǚ~ ]yݓA5kSmrwоgwɴěBSpiKE"̝s]ϫ9˜ϜӘp=/}uxW wE5ԁ/Ç>߃a_?;!ֿ݃=0lR~=5.~tF5'o_Mx`̶뼽㷟ՃSf¼X`8';;؂|xW*)vpDSeΘg-xdƒ)C0 /ukj*6q] 1p/+L~,g%~MkU,rqp'f@ȇ}Z!l\`/S~TQL?~'W*ҁ!{'} }RG0n㿏s>}x1ĵiìڜ7ion86X.|e_,((c1'7^F^FzxAj襏Z19Y7YcQ6k5<1p > ӒS0Q3|=1K9XϷ^,ys: _a{˷k6^&xr aGg S}G1Xqk[n|jcS:#gG0s'L؀qX̪ EvEH{:A`Ͽ;}qTuޤH3?ԯ nOs5Sq'TwvGO70lu>˨t87[x+\t*-[>S[ET#'2>Ȩͷ}ҹ=%R4o{V7 b a}6Q zHWc,e3l,j9P(TK F7J5ւ?sڹ\CvzC1YNC"AV\j T^7 rϜWT*F1# լ JigWڵ{nnc1.9GX3̃'};ū27~\m*Ug_ߪ{Pޡ]%\ötk,y-5QOoXĎHHܐ7x/~k=j5CzPU}.7~sC6K>97[M-|enyp v&Źܗz^=c4ZQԒ\yK5Xis&<ߙG ,X?%6ͺݷpi-߸/:BO[DX+>}_;+rX6ORdϓ1r;iy3p6ϑ9z|V%G[yqT/|^~PǝF^s|gDgGƳy VFlhb|oߊXQ:rYtn繞fJǭ8c |砛=u܆$ވ YO[l#wf@ry\-Kc/L=렯p?#罆w)dnn;%=Ql]#ϧx݄uq^by{@_uIe:Mz؝bOCk=t"Kp}S0ͷyF7@;xk9v)~*%z< g37.`9pћ}L^`fЍ4zY{e y,Fv$7:m>xFɭХ8hX޾oӷ#Coި`/> ;to>.XSx?ċ5M~j (XkХz|{Q\{#E!E]go"ce*̱v1!>2m鈳ߓˡ_"{QÐ黪B||551v,a`#Xtw"S .e?<v)sҽ;sN鐵AsWvs'ޣXgq1 1a8[GrXqῡ/` y=p<)pc?ų-> ss8]}ٯF̛S\Ym!>WD+Jz(lt >"=:A]jf`^^z Ǿx"^_z-Iom!^L6> 5&6Ŷ& :-+CO1j[f;!z=wۧCv~mϯ}k,-~gqԡ}_ y#f=P/Ն]]%lC I^0bMzaHƐ}7׃BA9a?@FTN/ U6'O2}X%/|r~ 傁_Ook=R!;?07y;|,/hǝ b~Jdm5udQsZjͮsGFSfPX Zv/=7'q-wĸ*gP3"V^Q1[>n뷊Vwɏ'qLaq :_1OXvU7Uqmr1K>aQ`|*`> 9WXhu^9}Vbe.$ 3s1 $ lX !a-,ɿV}Zkum]]>F+Kv|c lFb}T|:M;pmjY^gqI-]1u voXboA:\eЧsD ]SSkT!VKg>| -`%vl w#kЭIiȺ<&m:uGj5>RW 7juʴ⾬FSM=y|r 1}McCQqCݐUjNĸm _J>ə"{2' ԭS,'vϼY: wg~DYq܋LLw=ٔ{K\pwO̟ǟx^p _.etsM8_Sr%|qEȸ٭oE%Է>H,elm"%cߨÞ&g=ș#7b#p~ЧV1V{y?~# ,cfnvC~ KK*֌}Ggz|W͈sra"|`=`-UF_Zܨre \9гp6vߖ֓6cI,WmJe?tp_TS9kY/g`F;oPC^LNYh7jK Rw5Y8`Q09Kw%~]m훅-"~7Њ}qԐ~•({>G/Ћ魏޸xw{?=m-;&9>#Mc.bp32? <8pcULobc?o)x8ƣ1rӃN9`7 :߾w֓XAp 4NJ+WI'ԦǭtL%XuEO´?_{o[?;laPīJy>Sb?Csٝ߁w r/e3jyţKP]/6v-ONSȅedW~>IT$|.?Ώ.#ظS=H.ke6>eL~ǟ:3`Ӓw}龎z dJcHaI0&|%39o* .%_cs<'a?;ؖkj=0nM& x.u30uYBW>9{=6T=!tPW< ٫<t1Zb4ԋ#vmYLO_[ğ~{σ_D ;l+_O| "f÷괩?3t<'8,+M<%M@͗7:U_؁v0 {6&>/Xgs_9N`3);| jRd|yz!g =$'>^ҤMY.P'*Xݑ7`tK/[8/1}YQk鏓!ޓ L꠿=re2/>}? )v*b}Kn5[RGOzIM814?bwG!da2B]Yl|\E#pm׊ ȍk{pT76kX;uF/&"Ⱥkr ~`K"uYd)þnJ1kK[ jH"\uC%\=9Ӈ.ţdT$r[V΂u{]w 1Ե^ ؚP^M>BNawzڵ 1 ?ӕ72;]1,d;IwrB#^G1C̈́ɃJv(E@XȭeM,΁:dI-ڃk1/k53l.چB.MC: r,+_6^ &7pz=GAM~ {'pU!g:3 ~I38+8Tq.qxz74^dA=)'8KKa@yng&UW`vq*Qv {fn ˂%)rh-8u3:)8E?>1dS7~Y<@A% TjWlhUa!qߧFΈ`%`_g4%w=WGfEpi)muiČ9:b k +uiiY0ב=ޚ̣~38"ށ+^:5`ۥ`t*scؼLڇlߨ/WQ{!&~CȬdWfͮyJb;%y?۹|۶aRGB7n.ƛZWo:;WI?dW};N4lžoɮ) ~?بw+*g2O_s۸ Sk-뿏Z'/콑{%[$k:9'AU6x}t`u+6I%cWϥOvF۴,r?Ƅ]ɡңoE/GmrH!]:3W>-E#}~DfwI Dn)[M4>.:Xϖy3zGhilI{{y1C0/:]'qv1Kwj0ZoLLF6`j r&M#>gr⁍5+6&fos!ܛ@dd qrkcp/A$?"q7f@FHNtuEu&[gq?-0yB2߁? 0 NC7Ԭsl!m۰cvƽ1q!~-f`z!2$n=L {W>2c?^9hroMSO9a^hgӕ9TYsc~}U12g\row*vNZd\P |Myzı!ϑ1NmH9ٷ1{tN9~wqkt?^6{#3ѯXs?bi!?z /=o _oq[gxiۆ SĈ"Y8L=EOGY8q}*sQK<ڨIOl;o ci$zƝ%Kn3c,`. 3H_@߈ џYv`Ğ|Os3Hl`5[r2B1%1$t:Nma|c9=~=(1 lF0q))`=vjùu_L;uE ,hqv!"̘kpZrC9 !gJaٟ` (YӍ%[KKvNo'u$Wv19X,"]\qv^ڟ8pUΣf˱Oҏ}穮q'!y [K|xTa(9 >S?u~9k" Ι>6j1@aKF|*د.1džƟ玹Է2{Rl|^ӬE8by134{yؼ*Eإ$Wn^.6K3hYki%:'- :_>*N/@w>pϏ,y~!B?u{2OƳ#_g¢B|V>K1ӖBmA;qJWs9ϖdw!6Y]ڭ&f|y^`&zI30P~FjJ4`;~+a^vYjT1Ӄ9u0W=_ڥdcԓM̀:Xӻg b\cE5Xn{wQ^:5z@Mդ8k=9VɗFt* ĄTg8/D,spesJ5 c~\NWC-fm:p6vN1"{X̩e{CBcMwLa= = Mp} lEXYKCidGa. Čͺ+dH|isvuw8F, {Xw!e |G-UJ3)*cMXF.}9Gܪ^>[ߵ/obW̛:䔽߯<@Gъ|b_W%%9b7|{!1aee$e-=$t.Lv9#}ӧKU lXvo\{3(%]9"Yصڌy0-Yxd9sUSfCMFF_=}khruƨ %!>9r|~/3 D t:j8HW#XN)ȋy"?F6XK}wx1 EI ܃Ǎ=?nc؝#xﰱQw{CkS||עM_-3Cz]{tg`X=>x pwxSSCg!>O2>YªkN>ye}sBs| =Ș7~pBoLvs"k16Ȉ yسΣ{\}^[[kw v5 Lnuaë{c1`?kzozjן ءZ&mCg2o^Sl~;|ptOi >3 &\kv5Ӯ@_SHs~Eϰk?푰! Q{?J<~i ּ$TcȴdN9'Zk[gp$p.Xq~l\|43Jkt)}-mGƠ6ɛA]2LϢZYǕ6Ğhɽe| Lq~3N0G[J׮.Xul&VۆG߃Է4.lrCx*hׂݷtZQ`uJ؋,I$a u$~k6T}؆pL}/:T]X52 #Ի+jr,14J0 N2_U36෎5 @7T {8z4}So#+]n51i=z`AGq92 &x@nQ"_sqs!9U:^3ncW'ԣuUUu?6 olʵkhfLQްU}uc9Y3S_`/m"=0\xuzˇ]|x`ҰepjߑV{BwúVXKmCXaW=lKCX:Flns28gYAߠqnkw`>r.5I&5yVjUlZA?ޤkU)kg'nd[d[ i8^a?]H7VLvEn11qNطvQ\xT: ` @c)6G̭`\ lY$&sX KbM:smeɌ@OrIXb8h^A 6FEl5 '.R.a[Ža t_m ~ˤ&޸Jw> bAlt ;i_Xjbبò[j녈q'طsʰ6_9`ƥq3X~;|ˋYS!5pXH ;aӈ'%AO-pV,F8@Յ&bC{wj]]ɻ ߹:Ux*i*%Wf%"nj7EnA㙧l{{&Aw9oȶҴs:3DKNI˵VNM~Ga.xq!sW}p ;(/b{BMADq#<5׸ds XϾ=(t"+&r-3 sNNs~9}zҫ ׭ u#wY0߰@Α8NF|T>gI*BΚ%ܓuFYs˒OSL3WjX<)p>`3+E߹.+ڏ5Ƭzd[G^dEo]@=.=Bt]Øta#;MڒgyɓdQ1sd[XbW'y2Ss|Z>cJ10q~~U;=Þ}/瘃wJw./y0 C:',qٽ]q/v]ajakV#}~bk<ߩZ[mqs;ށD_) >CA%3\fM+I3}//ŖȘ-aɆ;h/,7g4rRR=4qo7Ŭ͜+\7|Ӫs Փ8yuTNV&t,b]u뻸RJ"Xq_!F?xr%ܵo%`>x(.t gnNΐWW#a"o1p13 +ؙocLv&Xq[s.;p7&ȕh{[y??6}5|E'ɦ>sݮ9bk>k>'Aؘ|^;k߽KȆ`$Ɍ(y#_'{SX쟂M'뱬Ohߘ6~Jߞڝ~vޓe#0o>Onƹ*;AkFo\/eqm0|Dgf$XglLW nUcm]}o-_~BD?c}ldޒIɈS2aȜ_lter 3Gaϒugd,{t朳HY|:`E*F_p ZXΣ/;qȦ߄/0wgհhԳsFco?h *^>fߜ7]tH:ibkibu?^+{Dg*GnC!~Z9 uSIyL}Js-a XoZ~UlJv06zyUO4'A<ȅ!Lf&\; 19=k % gkjɼgݠwlI!q-k_z9Y~nιc-hZ0g:z+c ވWhO˻ TO=Q,Vp*`rTt+pKl$ $ڕ4-3qnj]  CMjk}iwV{<&vޫ}fStfɥ#J"~{v9r \E]9i`SثW1/ <_Vشi]/͋O]+9-~qGiTF`YX}e+8OΑy";bp/Mi_]!뢕}*.`<0@q ZW[li2x_i4jB5a>Mg&ڵu[_x?2 N͢Οؖ>G]sTb-YAU҅ڿR؛RQ۪5M'ŪT`7Xɟ^Cҧ)99V6Nگ`\{[ 77ϛz/XC8j"?hOH؆qNg l?>*et>L%ց5+kWYЄ1jqVfDG 6=N*o؇3>Or6 s4KO௰=[v{;,{|־F?7ij"ym3ɍݽ,оC8{g!*yrq' c*1CUm_KWVQx#cڃ6@Gαyp8NrE+V@qf{>5S/RYiY>ΒN=tγu5۴OQ͜A-:%mcO5j":5\8hg |tkὍNNLrO{L+ElF%ĹH ڍQ=+5sm4q.܁un< .%x՞bl F6nv/-_,7ImDDisH~1A% Љml h$qgľE~ȐudfeU#5U O`Iϟ>O.^ ޿5mkh{?-}!w`ז?jwILMbq Mho&2Sؘ|}Uh<&q{^ ~mw̔E};m]2S7+iL!a<{&u#97]>-Nu-#d\uq1߿kOf] n;DAqo[q%`NTb+b2'1PTMF)bp1-bЇ:涙{3S<'\eǟ 𙁨<KǓ ?Mf S&iRF8V~ %FahT _}'uq\2l =d:njJl7YgDyTV LQ_͌bo"V<fBd92sn֩cm\-dؕLTGyԻSŹy)1j"1R=o:qzXu={ta>wm֞s:\/Jpgz*E{Llȟr۞3b}pRbMڪ0>vC:|+{ Y ú4.L;xo"_)1`u&m63cU9h9 YkՉxW-_|b/!? S;#\*Io@>^MeRgaC^F2>QyL>qe\Jh5cH>F|0-|E9/9A;~!΅f=gȬІnQ#= tb>VQS9b *G9}\|3C ig}Q'|n^TySan ׿!73E—We]Ju{ 5y5gkԟ 4q:NFgKmj_p։a=NsH0A5g[=2ĞZXk}\(badԬ3#Cil mc6Ȇq:tOnx,wˉV55y>]r:E[@\Q́xKL2lKķ&ڴQ- f$} i g(]=oi]$qt.8~Y,‡Syqus'oƅ=AiM+ـOʯŴ{H֪T;{ gQI?C y3pyUU.j'TPc_qT,o}ʿA1S^j,=U/xIyYJ8/yȤ#q5.:a (/eU9_Q91r>흊z#ZK>#X?*s\˽qb R:kGڵA&e3O3:N)Kݤrs]0hhiAӃĤ'WicMG&xjLa*SU@)ʮ[N{O{}]nPƎ~_F:ס?m𥿝wۯg6-}ڶwdKe}7W˂wў]~6-|7foBâ6pCFd:Oס*&۴MgmĆBo FyÜL,ԇu}f&Ӟ`m}LDIiv}*o-{M~dbQB!,z̼/RfCLLH,p3*R+\m#G~MN$gf4Iq_b#@% V1y FG&@twuuu\n=Ƽ</u^3îvkA`B}nzƼ6ys䉭rl$Rs]_d*[Ʀ!s&35b\Ǔ1#]V?d0/05(v\0LXN,ftxCdbRC5D ,'ZuP'WlD#/`"55hvjVg<\awJeGu?q"KyNLڟʰ[tRwN4>|ۦ!k>d3QFSo$S} ] }7/-XbSC}<ڠO Pʸ{&~0Z,ԡRȟR6z\ _Y<#g&69fד_g֭ iCM$ߐ#62UƸbW_v6"BvZ- ku*+ ):V8W,1֭,}ָWaU.58mŧhuȡ[<6R#ETLFGdUq{uݞpX]y>tAmڦb/ {-Y/ԂX?~4 RӬ- #kIȳ֟[U0F*E6y5 >{]klE.G:sR떩5E= |ͧu6oVvb`C6q:1ZȜBhVJ5ʌG066 ,("EB =/G2@,}3xp"I,\Ua jbЂ38F?ͿC9F p1qVy=FsK0^#os 1Pn>coxLD=yCb ?͊0χ >?j?f 07xߓMV6-oi߳ɷF ~ZܣrzFE67>m C=03K>MmH`\6dP|2Z_E%OFsT߃%SӡU &U5Jm rmaC\֜k *ღ\fS43mQr85b¢-\f>O[xcY>YA/1}b<9 3yX|Gkd=Xj\ܷ]S{)g4 o͘8|DrH|76vvc6l Hd{fm$$~9'KQ![22g?tFQ#(V΃M'`/ooH* π.Y 7.#L߷Qc҅vW-|roX58Po \SVk4WO`C:Svk:q9N9CE7NB,CXj4ZWjX:d`߆/ɈvJKWzg0bqתx(1 *F1҄ 2W\ð0F͍Në5㵵5߹cOƆNELVbxhKrI˧4{bXKOD؋s a !|Fy^5K!$[ uz` pʞ ~@O󩩯ٯ&fCŴ8k"v[]Or6 Sﵛzw! :JޑK%`Sn; !ϰ"z0idyЇƚ"N ?W ayV /V:>潤^‚Ƒ19q.e8[M;scG^Ε ?{{Et*ӿVoKpg$֩{"Nx/;Xg3ų26?1q/5m/p$L"[yqB?oָoen\wp*wJl%vp'kwȷYcb(:2AED\AC^Ce\Wv<4Z+˖ ؃Ֆ\ɬs}Ԣb3~ Ϋbި7g%'cP2m_OcwCp*AHGQkmk߼#snf]Q[1>oxC:ÙZu/?VBxq`SuZő7Ζwwy|VtN>l M?nVIЫsEhOV,:Kt[PR{wM͜?p#Ew5twhcAS1Goz٤]dyȦO^~ cAӗ }2,9H[Ci?ڟg G=Ŵ`tF32~ |(V}|b'M*]'I}^Yr!NZyyH'W![>bk"ꯨc'3!1jSs`OT\E7un tR[u29,bƕoHꋮݻ?b hhwe-v)OuE tޠ~|mo@/jxi"Q$4ì2yX#daWكWs?AXoi4[ǑP|Z?Uu Ṉ7.Mȼe`+ϣd-𕧸2/ӷW{7uJ{Pߒτ̝;%Ƽ{z=a/&\̛ڇzbk6z÷R W1l/VyGEyXm z:3pxz0V0zOfp;bg(qè^Υ{úbz7Y ۃ՝~? {΀1ve4tp^ON3Hr>Or|#g&n/U?9ƒL1Q1ۼzsz0*8m<vpO}]LF\9WѠ1ߡSpgU_)w+w{VWbϻKޔkbFz5jF*9 @lKT%<q9+wրR-6tG }?o @gsLM܈ J\e.7ʸ[͖R%c6tDQ[&t)oz{=9+@j:n7oUfj]lxJۑ!i}e៝iHspѓyW%<ſ9(U>J;6rf1,v {МX D1Od}o\N1uD^e8ЛĬ/ FrmNٚ8ر 6B q1&&?}O3]MsyE8f?lY;m`+Ck9Ҥ!Р r9@~Y]!רC3{ޥĦm-5l9dhU7 zs)OΫ>u.u`,SWGoL"%nWȰ74=O8 <~`|YC4=9G8C/Sm#@G ~" '2fȑgغἒVTIvgPWg{(~MFb\-kRZo;dâve:Yj^e{Ĉp.hS_4;3I ?_x6,4?W V〆.C"QP8 OhA56?K\M._ā7$LXq망s#Bq& xt'V ~ĞY{wy0%a|p?uQ_E 4`}Ax|XClk`/(w+ɡ%.X6v usoy8k@X8L7=Ɖh\s΄&q(}KyF1.;1}]2>4NarLuUZ~^IMScUy7\Ƭ."A3X_cz<x"sz#Kt}.h&#ym]WUy-6tdOK_|soߊ?CWifuh~19ٍftn3My=%}™u!5wc. _Yy0ǹW |b=JOrh0/%OQx"\P6!m0 1瞪I(9FM41 ߽ڱ^ ;Gyb([XX;Fu5~Κ:=4Gޅ;ϫF,.n+ҟгu.F6nVHzuj(d)]wh a m]оVh =h*&QWUd+Y%z]};n_W:W4wqvWXF ^ٯ ٲƹֹ*%ְ :-j쳳f~8@Gy3GUިU[Р-5a VMk8wlXS$ UЌ)5Xb%&}P0xXlg_t\ɷ记'WR8E.W+fO'w8LRH oYgc ue\0*ΡX Qb-W|/RǘW{wwas/d*=p*} .wMscE7}CgxMP+2ZMh W_5<~1ފfbKo9y֛Oc-~9 9'ac~FzS0x3uǨЍ-'S`F]c2%$*J6,z7풟d5jdZ#r.\q?ldW9+E`;`Ěro8rF䒁u5Ⓣ]q"8OyfalR3-}(.[|) ;&mhU-uu'ڕ5YZ1) D_CӖM>|xkW/CO{»_謜u:Aomo‘V02A0|/|+ ďEyX0FJ,ӎg.*~&VWag6p]aX)QܑH(hrhRK/5l@<:qnߩ•];goDXv7TYdȾjͩ^~ {9 07T;ӪD|6з; p֗`)Ӕ^&ⶳ@Iov|h"}M%թvZП.w`DlU;-{϶゚2V,koe#MUG+ AgQȜ8O_~2[S)z b|/פ/F?ˬq${OuUlcjea9,,<7ڨ1\G 2##"#G}4ڂĪ&lat*Yܯ땒'5R/vl~KVY=P=AOCӜW'j\HK0G7>=S| :_ m|̓94 z_/nm}` ϓ@.[KщЍKv/_BO?a;4~zUtop~Y݆徾/M؏&\Rk{ؖoɦ2G6NdzƼͅm*ҥR99/Y`nN;BӶx$ɋ5BVR߬bhbs/}lDzvZ\ؓ^ :c~Cle;O͇V`arv>wqw lsjrբ!(iԜ!èr g]uBPi(vFŷ̗X|t=h^CS_9}ByͭܵGҎ?b}ϑE|Bs:%J-;';|m_sа2oP+$FA%I#v!1mj cK=&&53@jfK <N[xC~ԽkZ›X 58=y޷A7r͜ӏ`H)X#lօC.B3/5>\h6fXk'!ؘM;<ԻsMhȹKd[eK+@{ gc̚\[y!}URݝl-׷,x1ܒZ[Ew`uy 㢴}dE q0Єlqή`Zg|,.9݇^[`ޡ# +/OX0sw1_ޗ +›]8#}?Z\B-tafu&Gb4䞣?Djèrg܇ĝ8 aZԢgQ_Y׮$sPsvxvcwR34j֦boxD3{{9O4#ŭYj<~]v1TX4ٟygP.|zF|!1{~ o/_9;?xw3;Qg+Dt7COKsG^57D4>+6ŝ&RoZ,)zCV!AXY`+֗"s"۹7<*[5A_5ȸH Khch4ԝnNq ܧ+ѻ jhNE֌.Nu=e]]ѷZbE#I|zҁf(3˗{a1CQ6aɗ;qq07KS)8wϙYftfy +5yĻ<{$),B+b YMi=/dr)[{\bm?]s97ܠ׎pF{soxd'օC 'VI 4E]_D1H 3]=%) ɚH)|7fM_ 2^DYW#hz͢?d6l`{@w~ 舱sfgR;KIa?_}0+| ms9 }g0#.s0ϱRƐ̇3DPȾY{9cډ;16;XGwq/>Vֹ@|)< ;+,2aS!b6S sһV5|+~YQ#T7V_J~]mяPJY+9kUd:i䌱vhyZ}8;XEP[3ۃ6CnC5ځ>s4u8|Lܣ#9%yP`f&=V[LO1lud,CR%t&wvN{LKtx4+`?o-̳`Ԑz[BZgs胶Д~$q*k޳KHu~*ZA4h7 G'پ2׌\*U#2k[ܒE̓ߚk 7`=, G--'/|#>ߑq{& A؃^\0c}!?;&ZZ!p&oxXsU`ܕZUg'_w#Ӳs|{rJ\a>ot.,)dׅy-fގp Lӗ!t?ئ2둧]!.|?@71Nb?}Z#g 79G^ U 7j~Kɡf%{_.c"^)`4從6D|Y7mc 0 ,߲c$$&H-ͼǞS"G]Oۇݏg]aTkUQ.Pew{QL=ލ3vyhwOO<5qm$|TH?=ؒ\/ l2`{Y.̲iEWKa5OTXb4ٹ[4%^lKLWoP&W*dIU@̯R F8žVzT량}n9x!v%~yyc؇=0UsK}ͳtw{Z{eQw?'3 |D{0Nt_SRҿ٫ʞԙЬʹ9o:WSԁ=ȹ֭åz|vT1DKf2O.r{_tt6B_h'µG${A^NQ5na5VL#KڽVEO^Ry?{Փk-^5FSyإ FhF~=$q(Őz.=X47j2ѓ ?x6|o(C`>'OZ=s+`)az?)ga7E..lYj&jj:5`oUMu6iȜ##o/#peX*aeṋ̃)҃:x`s:յr3ތk 9+a  d=Q#./wкͣW,y{'q6.7}ߗzSg0rЃUhE^ݤ5ͭ7Dc7v̺Zځ{\hR9Ǭ8ynldL浒1E[V!s@߲+Ypu Ns im?b #j' \7z+ }C-jղwO27[6XyE˄΍qDv=.GSU9v>%,琯Jl36fQkϥJOJ YQC9tle3mc1vcrwqjCkaɋSA p7t`{s7 l}&:]?`XW3yb sl_sb8L%|-peG1pyj1f=[ZV nH.à p8cmめl^gcda#/x $.Vw !|_Ҳ쥯ǜ >qH>1둁p'$< 2n44pX%p )lCvZª-#.l0<&{XG&Dnkp|zG~Lh©d)6Ն"(`k&l .j& pD+ށzzq z'̇&p]g_#~[{9c'y!9cG-\y_ލFGvtx_?ڈX|&.TbBX7*[h?= !ȴEVmԅF<\@9,-hf\};@ UCǔND^F-~2$Xlӗ K#L2Oy\A]֍FN6quj{  yIcO0Zć9[̫1gϭ|ȽASȞjДGh!XB ?ޒaPo\.Z{DoIށrlihC|ksn:z.%{eR^eQ*ܤAU2¢?fU/͂<N3yJM9' 5`s,v l_cSsP{`#бϻ3#kb4 g }:=B>;V Ki_C8?:| Ψ )leY{ j[6g{6z l wݑ^ ]ߟ_ܳ*п~Ei:T3}GX)0Ϩ %\O?[j̹iG`-s.3JmD079Ұ]*lKh/yճ69;GLw%3EO)alcP63vsAɳIS3P8Uh4Oά3gzSvs[\̡15(as+]ۿt=߿u?7s*-ZE~ni@}X=6^[xg*.?O{U8Lb2~1]i#K[uof+K/ SؘHڭHBB`~E99=dkhpO2{|Vԇ]%Y+q/a'( O$aC!T,\?[ĭ{0=P8h,s>,2%_FG.X53ܡ4ҫidKis,0}K;'s jn'N(]w.}w˽!\pC7@`ɞ2Ck衭؂l +a]0(n>* vC_'R[X$Q%'3_,4UZ{TUgyuOOYkZ̖j~< c-יȂ0e?`cFι셜w-G^V7?m[3/-7?Qp)8se 1󩝅FNx,_~q8nwɚ kҟK/#3y?5;9ljn1^ڒ1'v4׸C[AZ&t1mm1>~ƸS>m^# ]&ͨX{㞛kSb FFE.Ljܛ,z~^; '྇M4 ?#6zل_Rχ\Ğ24_c#]H>s?fܟ@_vҕv&*N | <m^%&轑Y= Iۗ®~Mo&rk3FAM2Me ͽM4:üfo_p&tN7a}jXs/4*o|ygɠ%Z=T÷e'P&ڟ11hr&4雭* i_=ս5Uۇv9ZZZz˺XQ^exWwuɫg2 lRCCK+|q g' 18ҝ?eMaV'Ky٬H=w:p9'E2v/_˵aO0S9olamOsiZD뒗NUju|ќr=z^_stfvFSv16l *WD ˖J>OL$q9W{m[/=[_e˩%PXhe`b;r:zxϲ/C bMunӐ5aAlMjoI6ރ-y[ZWG=3ZbGK] Y\ c=ht%m1.2aT2]br9qaJ25ϛ<7i+#)ڰ ߗa:О>m Eo9BlO8u[~ >Q~?>8ԼHl5ϥ0ẋ8znj/vҿ|\}0wZj/-̫c_Vq/]nft8;eK%#'τeɃCx:ص%Gc,.O3 Jl訳֤;!c&?#bGo cƶgÿS6ջˌ+}bPVs5mˈq.uG=E*ɉ|r%"roq6)oɹQlܤ~kAC4p5F_WÕ}0gG0ZK =V| ?P -33FI 65.y,[-!q>550;,W-{Uܵ 4ػ/OxF08٧$Qw}hXWxW~W|Z7Xg4̇FFTOWDo Af:8K]tK4k)zX XWzꈟX`7AMl!3YS=?_U$r2~p/}]?u?!ΰ`l?w,fqX9$^yAE sc.(SG,w oɝ%b7 GgLw?Ig d9\8e_4)cOPCc:ԋgR|  9rS 0ƽㅰ4'5p$M;7`L* l6@o}J}ذ"kVwgO$t>dQ0i1E2N>7jX]~ŷf%-,GW?)%0YS>tꊁԇ*${h|3p? zﲠ+6Մ{Ӻ'vfGw>koMθ"oi!۸ՈCƉ+vaoX>6ڻid[E_ಈZ˩s$w'ԑ鳽yĻ8?`VUkա՛Y4hJ}~;;"]f4y,h,M*dv%{;}tjy kmZ\wTWrZ,'|m, O=  0ŲM,ɒ$LQG{kUnR:0׋+93A hkc[雱x3GW$,G_ӗ[뺶9K 'B[ftOşҧh/櫩Ծ3aBbsT~I +/̘#eϢva% 5_{ 6,ށWӽݼyT3%g.ɇع3SL٧]ƼtYN)OZ^k ѻF^9ژed% 4ܩC *Do=^Gû4|Xw?ڐ$xsJڣdѫ'J{ESdHY~9:%Uw {)n) I$nG;97^(" 5HF|>N'Ûg|H"0tj%3_͏5ڻ)n2U֡4uu:~*&Y⏎4#'zXٯg'4Fעk8?'5c8s Go= ǣdHvf{%zwrJJ37yr0\?3+x»|ose4z9Lya;w ֘n\ݿ~oA|uGq> G"λ] {m[?sVά;M͟=%6u t ٣\a']ws/~Fy#{E>ˣgo0m1ȯ‚ZL7Mͺݚ's;@YC.#ۢւ/aA~k `^v aώ؊QMM+b٘]oԑhkMɇVCfWr@|9j` ɥ2Щm &-k&oEg6:`&&W:ț´oM~xoꈓ-ṎЌէtaVk,rށ[e[Ĭ#/`N]8z-$[B>{gKfV)֮>hG.^AE(<\9~jymwObwdP'EZK[Ii{Yl38({ "m 8}is֗9{?Ѿ%Aݭ؂3w>ta\g:zwG+o09 3'/m9q̔OT 6|%APl^|{I3Yے:6?臵S"b ojVvu&Qs~~ }_uո&܃8 0f3H|r)Z+.4`%ʯ_h{wMr)dc2 l9#=#>fx[$1>~ Zs.G{>?92[_dZ Uo=̱֎qEs{_M)lYz aWihȼE;w[4 ›E~;S˷qw6Rm0jn:"y1˸}"h.[탹 3ٱom%P Zƅ|uKX7lAcMoRQ2(E)@vكluwJm}[\ K1?X/$O8OM7.lHSbW{z·&&uDv>KakOΦo,*]''BMS5}TXOM?o`>Ϲ_! C+U>CTX_WQg\Y͘!Zsg< i`J652RC̸wCYOtf<rC9gMU~g]I $wcs~/[bԅ^k֦[Bguԓ'ё>s=ڔu˃6z)?Пak?~'T7 Fu711];q <ǽtLD8:N&onݫ9D}96 Jx.%?q9]]J'llc0^qE 9$$vE f1K׽3^k}ZJ:$筬U}?}.$lL#ȹǙ|wepطܛ+_dh%$[#&9e܀tmoq-ޛԸF4nkʅ0cMW#M~u<\^fҎkWe fd]88艆Uhn1NK25Nk6;пYJڳW>D娇{F>_g1jc-b5*v$wAW2a9Z^_>K~o\[CU)߅kt[A瞶yj^6\$+v8N1 d`5Ѓ>@LPUc@?u(ϓ}R*ކ|䀱TgmBab[6p |}~8Yv/{ ˉ:Es)UoVM=:jq7'5?hf㠹K>gѳS>$~4|RW×^ N_vK,QGA ^vNcI6h NA1'd>Ջ`K+`p+|Jߞ̛oC2'Dz'}K(}4rGN(f4KЇ`MI<qOle\R?9v>~#vFm'kMգ7iP{PpA&X',G{!>E?Y焼Gv߾ݲ FOv?s)kqIpW~12"G[eI.c9~xEY3'+؉{ڻyrp g<[k2>q Fogt{xrgb~n V?3Ѭ/~.`=7Їk| fPK&y+cX35?{ɼO~3tqj[;̸blFzOUNn=bFxW2ǣĭ;3žؑwd:P:@G{+H}p~LfuX{~=םhKiA>Z?\r8 u6%^cm4qG&qWWΫ2#Ɣڋe=}6_GbhֿwDJ,PE=$z{!k,g:!o(rݖ= :<8CF Uk~>OqQr`1d^J6xw\~nP[Qs߬K[>Ʈ/y#>"{⏫mXg\\RP3a ✨Y W%gW%{x xe:2Sjs߬O'. N=IS`TaYsqp{j2u.fL+I?J޾0 6[I:H9G0DaɸГG"@[Y/Ihb]rNok齖x77ĂQ c3*)nd_s }Dfkzsx)xpX~%:Z>95v`]羥5!5ŝלے:p.0Z0mAKז@CdžF7ɉYMqbO|5Xc9u4C1sk+W\֛!w8?4I'u[K3"[2 9Ab@ܳpPnz1zšCֻTl'ׂ_ֲut[Z=&Ƹ>l7`l!kѕCC|nqqz #+yU'[E ;ܽxr\3,CF}Noxq>-!5:qUSՒ&,̌Kjy.괩>f5`$eP#-Bg|5gsΜGkimy_z9Vid<h5XǬ'pPI 7J\yn3&դ7I27q8YC,ZSU@`8o v>ת`)`(ɇ LFh9s̿؋NDbћ*CB " G|ۓ|} }=a* > Xg!EupXNrqЃG̓\ɵ򰹕YcԠwzy|8>@߂KaetmJ{TϳyvAhGdtEE:Ksʰ__{6>H}fv9"HX'2|+Rc,h#V³]a2b`|8>UUM5@mmZ472_۔(д9c͝W9MaKɃ@]m_Њ]Oe܈qxB[~&P|gsGѤ/7WN@[;2~| ChCĸ{ȳ^ຢèW>d6/?*n}HÞw < MRV#ÐU Ȟ{[y=3%(4|At~uoOiӯ.{/z{r[w?jL QW ӯk`g~뽼<|O=[q%үÍ<6~H[ߒߚߤ_x)`;̅znӒ?ކIM3YOd .-=,cvwQscx-fl+>%Qj痬l%aNN\نA?xdNxNu}#}l~'sW;ĚMG̵y[kdO!& ڼ[ɪw;c-+>;YH.L~վ^/ yG<IXIt gǍ弱G۸>.Ca,:= z6B6CWdE4TX/&2xD5$Ad+挴]"6m?r~v,z"zed-3h Vi$ k{%S@`σ'|:KZuX5 dfc}~b9VE=Fϭ2'˱hϩ!i!O5ƭpx]ت&~Uz7pl$Ѡ=$ 鰜Lw9y]Iէs^ =)|&%M1< ƭDZHşxl&aBKv!@|WYl!&#ɒe}=KOYxFɸNipm-m,4ywC(9k>3X[p8-p#ƐI]^X2sd y}ZK>kcOkK>tX:Op,?YGp=T8Z͖+7K 62oddM24N|y.0.{Ɓ9obT\{d]<7%̂Ϝ N"suR1)Vj)#[:P&L muj0Xy6Η|s+~J!y>h*^vap Fr}z]T1)`'l];!`eu`dAD]=/ ZLތLbmy'c*]0iC|dshׇXUyOaWf>Z·Ab}Zd߃~U;ys s1AsXkINI{`\đ =ZE^[1ҷƨKBXG$',5hkq=O UGӺLZ>&5 e!^ᝪxM%?2oxZ! 샱𭶰ªv< el*'۩KjH5xTTz°> {||y_/zwGԏAF3%;o_u9zqCl1|PA;Rü}dwS<#z}/|,ߡ:ise?^~p*{UiWXd ]/9OH'hZ+Є~}Oiv x{tQV?BVv u7 Y/ym:F.n֕0 ۋƎ~ )ioE66b`mrcL-r+kGI ݝ軱F ܱ=S3O=&'m+^Olk>c,"N5|aJM #w`A̡S7XG>Nۊ#4bw]sK.oŷcȮ=gifF:)#V#p50[ųT_3αzbjKRᴭw1&)-˯z2e\ms9W07_xV[#`Tn`.׍X3ث$F^B˿0+> yyPNg~ٗŧWC 䯋3|8<3yqPuW_Z^'z:6hkJ0~? YgdϟYp.yeĽ[[}s<*<5[<h1>6ȯ;֤ dQYù+[crWzNոo9uYp6yu^]ol3 =GNc{^ie<"Ez^u-vk;Wy#Wcn=}1x8y^?̓i s)ǧCy4}iQjF3ڑ%sY~;:YPLOQZ=3B4Zh1@ߘ$ gQp]{tB䌏b,v_D4g|8'mp1ӳ* 'x^pX[kb:gYGoTzGlb泩y M1ŵ^p|_F?/5M`,Dž`1ڃo*7,Kk v17Yƌܷ҆0f֚5V.*UJpK!ku}sNM珽 sξEb[_ܿ}|tZɬ,25dE :۳=v0J&xVɈf5p.;\ȏȿ'$NG&bf3{@׃M|NUbJ̭7vA7YN \  ׾a.CՐ&nX0L s[6q/&_!Ob MpN,uo .1a3C&`O&ߘGwc=Fpn}A 1f=IIBu6oY KKu2P#2b_E*ɳr5+ɋl Vq] HTM}h7U}sxc\kɬqÎaYFp*#7 A~xV+&2kr>eę{{ pmՉi?jDoϑ3T/'/U<n`.aѴYBN,ƮE}c=l"͉xTF.׼j%9ы(^`' SKH'A@o|ƜY Ă[Ḱg񰛍h^40)z!^%&cgUH@&Jj8=ڸgs/R>OU1.Zɵ>Kς-r=\#<&[/PLp0#A1>4^" x6wt篕"{F}5[8ۃ#څ.H\h<<cY:Ŭ} {`G<ߌ#Kg_(wV ܝ#3[\ 0_xO|)L1qӅ4r5_KkHǀcbK89M^:0d\;Ht/C=MԂ|j'Vͳ#:|M3ʴQ&)[bgYL<~4Z^웕ݘY9hَрẕ̌yv9n'>|ԬC,_PiiʌA1#c5Y?{ȄUt;ԏbυ;:U#z6##X՗#b/'u% ^;Z[\ uC%{0.|Wg:jwNI3'9=ƭr|-`UyFحPWiN<wxa%E `. sNtk̘kثEy^WD'f,fzQzzq .jngZj!Oҭ}z,Lh{ QC=z`ؠOƜirNia,pOV?z\ԯ bD1=ˣwyb=ba@\ЯKeO`bݖNgo}S_GҾ 9xtA:W6gekmnw/D&~3̊Wx/M9nU>AsbѸmľ9K^;ѶX;ⱳC#>"VA[]gMe#rt_eIuz=5:UqoCz%FD#ea?jk]{1VBz) *D=п~'}u$lЩǙMsiҾ7C,U-zrc^ zcNS_I1MԜ*e9DaNZC>$]Cu;t:iO=}Oy =(5Lk`_qޟC1t_.c1ωAPni=oq'',]+Ǻa1VAеkb]ܺƒ(Wgui:I LbLlwɶ|t:l$[l=-1{2PK`SN|u˯q:C+v=4n&r>8Ӏ1O|Gm87 w$0t"C7B oI>eZmOĸ3' uY>w`XU.?`͏d YX lx|XOp݉?F'#n k1-5zь&z32nc`\+O*bɻ;& _jjTo8sp[n+悓Jo4=4yc&l?O$C'ɔ {iU~0X#Ȓs { `6VD3ujI, ؘe` lAcw%]cbK< <׈_ Rb>f 1rTCe &JD,ȃV'W/EvObM;y1kdi[úu7: 8kc2 jxW5Q&ב)\W]ҥtW/8Ft=2.B n  ]eCd]a 0,s]\e&v^tPKZe"W-':op%%UaQmapgq #l^ ג=D H&K -E1wT/Socf8+k̊۬_cԑfXq1ѓR@c)MKgiYGgz#g 8ȡ죚aeq?kSrjdzƵ4}a#n]pC |0.)oZz5;s|_0~E7]_r|GGvO;J7G|Jr^hhk :1FroYBk43 ֪$pȮm %W;wWYo-k)Hة m]ѝBm*J=;4ݎ0&. |aȂk|j!ڑlyXNjy)3D; 4ϋ762_ 'zNiT9Fo M|^c`*b\#ΡR2W#(ΛOɫS ;]Źjwh{^7_aI|ܛ?] {i06?<ǘ#1O|A8nY{SAj{Gg 1*nN|VB[{q&[8, nP7Ϥ-=-&FMi.sc)X٧J={XB֎"}(|f:ǁMϟe MۑXu=y'bӘ4~ ͆5LZ# ]u }su0pwoR].6 XCZ. Z8[j9K#_Cỽp{gdhYǵT\c%ĦJVn$X _"z9wAga᷀L:n /=Uv@X8lX˽`ۨ9\gFFuH"+88:(/&+=4ୱ ۰V PzF&݃v3V+v6Y'oZF8.%+i53fqް8J/un~ɂr96923{Đbp;Ը7,i+ ًCq q际d}=RSYߔou*j9`0g}Q"|HnX+rg+d-276x֐7$Ɔ3v}7kMU-l֑mySzr-+며`VS-{s }DIJo OEpe¢VY^!'0̷k L|4/Qq34s/BKٔچaoeCbYbN=_ؿlԫ]&eAb ){1fwko^%Qv~gqlۈ2s KnwrxIGA_X6)Gnm( ?[PA4}I>M?表S 5ľ^IN9ễmXa4)W' 3};٥y790;[?q_8 q?V$֙pvLVf_?Cm= s=;éI14p1юzc֨rK#ݝٙY3I5QcɈAE[沊4v }!=yO;ԯ:un>~/t0?&hho͇'ƽMZƹCSuy mgn뜱NsKLƭϓ, /.l6gȜaKFgIx~wIxzvL '1Rؕ b3XwZ9\B#?S8>Iu-l`qQ߻Kyzہ :gpA37 exc; U;.)O}([du5^ ( jQ g,|`[5ރC8WjQS~gXɴߨM1*K+d}̷-,Yq`=wf=0޺Ŏt^Ǹϱ6zUa_x[G =؊O&F]u|;l\qb{]ko>=㮑[JG#bHb]cEl¨U'A}7oiSeyJSXkZS$%q7-XMu%_^ [e1?51Oi/8  WӠF8.wV0PT/iC_FaX~~}=>|E.Kk=k7bxseoZe9iygULtcsy{J^1omZ:*Xay6M}1yL|l-:~^9iP]{"̆<~NK%lÖxm~/?7wNgsgɕE:ˑ,?צ{ǫ7LU1ث[L-1-/ 6.I/ã#rJ/^e6w~f'B:; F^qE+]uoyt0PƾҌ$Ysyʜ4u10|s#™7®6?9Ig,L+Fصdx1-cer߹Hϓq~Θ&=g?MF6nwX~ 'vm qbfODvXWW%Ď'<W㲝؀@HHH$kuI^M%? :_w cZ/0:|qe=g;?F~F?\v劜主[٤mWΜtynAy' \;YqjڏXFv^_⿅5f}.ő{~7dbj? ֛^i k1a>Nz` pbQzu#L)Ϻftym_M*{,*L)v [NL=8Ɖ0auDno X_ttOyԻ!7?)kb+7lgjYOl [CljֳM/n֋uS1ѓID_YLCO~r GPتJ\8҅[`40]|x;h5؂] dM@+๿qiYmԜskm#g/IUaKş`y}خ`hdھ܏X;賰]M#qdOΙ}d#-iK`/cqf`1B\i55 2xgQ~B>$b,Տy׎{ڝLd$40 [;2l'::֙'Ȯ9,J^ CiHx33 y3X󮈫Gy 'wL,X?GbSoN$b)~ǑDtbw s|2 ɏw#[d:lLƣ1 /6;=Uq`~ !b"yyUw<rGPzz ;o}.ZvIL;!WKlЁ ggmM$& "W9O׆~`,eSϒzC"죾}ZXK;ю`B00}oC+榃&{]% t߂`k2ʨ!8O r#rg@3}G?Y|E6K׉,icμq|E&<1ar^zza<֛gNQ:6Kӆ>u$c)~@:}/̽#{֥wVw%a}CtA/g)!9/:6{~K-՟dlT#:) r^D?Z[o8P{ћUѻ9諻Y5fR2^%pc!o&RC}\!a }}yHn" w{}/zmbT-PFo|x@$wCrivˆ-{z/obw!ثx-gMk|~_]a3ܳ[{y;Y~}~q;G0_5l <>Hآ Ix{QGz˿' ?u6>bob.$>G01\%krdU϶%Wl22Oyk*쾾,6{mL3%7|0F/e{F 72OUHzo0N⿹ڒpqDUKM C㕰*Tycȍ=#=`Fb6-cEqI>d }*Jr¬K9,9O^,BFVn6u1w 0>e'wa̐%|ܻGxv%G[q#,mv]N9M01<̎ "x#jȳ 3!C6 ܲəYl)\:i$`)97n^aɅIU'[=zi]#L{dLgY?ZxԶ?tjՋY}a3LGX(M0p6c_ɗэsm-a5Y38؉؎1 IHCWi㬾nyɹhػꯪM}vwu։8BZv".sh~g%_SlOe?,#Onkf4iբQ¶80}ΆgbnNҰr 2㤎'E>;h\:Jz!Q":`?*૓N?rx_<ټvˬaٱ dyYZJ6z{Ƒ]'7Τ6? ̛"S갊kǩ3+AQMO̸^;&wƜ_9+k9 K{ sI`#}7+$^r_<#^_+OǕ/ɸM#2c&1?y&jgx }˜X-FvuFhѓ690A.U)cqy3u1?{#đS\hGNɕl\ 8|`T80[1չX+G>D_@fifA&wf!>J\#qn s2j3QBN$AkŸ6sϷ\s~m=raYOg0Wر>F#&BM|<jf!»Ic~x/3+V~uq~~ omAal!wdf;n2>ڏ/RFa9E~k|3þ#a'C|w|Y:[qm%{kCsn}7C̡mCuȭ:m̴0ܺ,1`U׌7d>.gf}z3\'|ga4z3+_1́U$sQqh3XKK?(Lw'rA Zte%qM[SY׬%~520){.gkgf|nXC8|vJSW[^VCbY #5%Hǽ{'8# =ȋŒP aoRL\}5 sy,枃YOtN՞^Zyť/R%jQs֯g.¬ZzeP5Aƒg.f"HȅtcPڞ~P-ghOùMރypP {';P~z,KϪTV4//JG2q}Pl%ԹՄ[[[kN24ܩSCHf$;lBfICUœ`'vnxV%a. `JzDžZV3*XZƽsI#6ms5æ%<-}IЬH䈉]0 LؿLs:֫ sT,kA JnL ~jc;:c=e)өVUuM~M]iONlGk3[&aُxL'f |8TOCqh$*q jT=]تG ݁ϭ H4iVy- Q%^]b2+/ܙ F`\+Nu \ R`onCO}m5h6yjn7 &Yl KlcKbdqRzfiSQݣo=kw46> xN#6^#ܹ*jrX|r-)Gߪgg{>TKC?}WeϠ7FlIkA2cN|.sqD ֲR32k+kV=fȯA R7 ]M @s# (aC3Qpؘq3 (`pڮĬl1gr.S-j7e&j%>1]C;#VkQbk!,jzK~K|ɶ-u»ѷ񟟏"eڸgOx?:+-zqe_̺ ީF5V#)X=szA$j[6dE~s#6oC;+@<#h_FYa;%&~뭰: n2l{gm}.sd_I&‡>Sbdwu:ը+ Zܕ0Ic.9b Jn cy=ii6R` r6ri1E}\s}Jw[I궸mm7Knk^bb`u𵙌G9ViB+O"5]ᰁ\^wBm;8:^Cg[qϥ?iJnqLg>-یٟ_ټo?X_k{tǯYѨmzd$ _j-$?QW8<3_ɼdx[Ϣzqٷ ޒp"E ̭fJx f U  C o p{V̜žI 6bԟbbʺ[X|VDX +a)Θ%s->e3(ٱOv[VWyZ~h&$V~5x!{!e-,[u7_{9V~uS ('QPޕuGNzrސYEu+ls&4Uz%R=0­s<}P6Q7j]yڎ9b6[& 3V4!vU8$dH[Cŵ>2P5pnwɷ ~\TnEƞBA^KOǺcMpOynwQyM#w~{Za>j\|&~c->DWO~ExSi5+uy)sܪ c읹99^>ޅD4k?jnșp\3CsGeu^yI.Wyn-ڣޡ[Mϣ14Eo*+8q65BԚHIM;<]^[QsUQ\v+_%֋$W<__ܹ*8PøX+}5,ᰗ&I|$ODy߹%vtQd̮lkv1k+yWWx6yw/󞜊gs˞\av>ӫOXu0x߃07,{I>:9z+mwԼ}ͺw|Q㫆=hc~,x\E.z L!~4\'ȣl~dYah` r"g_) wW֥e0dI͚yC84ѼQ\9-2ݬVm6Ōݎ [:̛٘  VjbЦm7Q -omى:aa& U §ޫ׮nN4&Ѵ׭j)`:֣y'J@xy:Uy-UoZ_Gˉ<P;eaOFtNCY9hy4mXX}KԮrưɼ.Gbɇ5|mA&1)Ϊʜ}Uϰl47'bBO5ϕqL>~Trq2aTC}fȳX{ȑOo]`O\4oWW;m xm${0W=0jd7'QMZȗ}/#|lCXg4YI 1mBzchx07DZб!X]s2ovVS cP{'Э'C2~ 15D2jɢ;̇93$dc 8m0Kpll*yOl$[D }P :^$Ua樟[j}>͓ Uh7ȃ#緓ȽA<*!{y=yV #*D?xVlG@|ȝ4%!F}wFL2uޮEyڋw`éww;>>EO%<(4vԲW-ԩrgE#>ҷ#pxݢm%R_\[&灒yYȱSONe}N %hGFZUsg೷=:{Vɷx?bOrHvV. n8v_A/:׷ٷa7!u8H D?:G2GfDUّ޴`Q ;)5 w avRg-kا殦聯!R?qO$ghjZ˨)X% jg5ff{SOˈusWgnF,uwո{(L9N{X 끑NlNsSחMH>}ϵF S[d-ǵ4x5%\>=~ x ]d?"'Chs缑RC?Q£t:S bYw^^9j{;/atðVAO.}9Gu>Q}oxdgߊ%j5ƣ3;˵g?%ۨK "Ԥ*]ieYOxy{o.jprp:|_jJ=# bnXXZJ+#➟Ԩ,a5qF&ڻ4\;W%TUaM #Z?7hTY gW9WRC@P89p/x]1_umϭT4,uNBC~or?E+F^e5_"UQ+{E<%^E oq ׇFoq>kʪvkG4x/5b]/V| |SrN~eC!kCMbr+xZY^ hQ^㪜zbou;w*߯Q|C)jWX!^ؿ\\aq9:8gKX0S|;/9}o08aϿd,_k|~ F =ĸ˯ mB߶;^س1hzmdH0C s|aN.r_|^ 3h ̽&=׬Y~_3v̭~+lꓽv25m˒?61H&8˚?,8 l\oӜ$ֲ&9)¹̢+ a:F4 Z;2(Ȑ~mZФ#}SOZڽ> ry<$|UڐZy=g²` 0AI5 zjpdU>g7`M̅-"Ug6kZFWMU^{QPS(!FG-B657ɹ'h$,Ppn.]RaT= 90BC-]nImeEVC65p`ֱv̙\`S5G\] s˳r컑CxuPAy \}}yE_zk|;",>a=8OP'Z871Hխ >mh>,>_{žl8jk;Fxl`dd@=2k[ORKk,Oy\ 3 ]nG~u m#jr֓akUgE6){<}w],{]{K۷|b:4auїmYs2U;4:n`K砼DF2.=JU޶p߰ߋֿ5FJJj8Fe51PK_5q@n\cyeHFKeib{澽&9k;1?a{ly5jPjJ ߕɹ!?u+)045jMt*5Q :$LI0t 0Φ|U}' w# %7n_E/<"ː6y>&d%Rg*o~McS_fİeCΪQy9Z|1n.57oɘWkn/ GZ>('+yqoYiPB$Xo@Q+/g .&d?kYb^um!Q޻k9f?{&s!|kہ'LB5βc0[44棑 f2;}?'⎱'KMyhNz=M#+'y]{͜(k7p^ M:1/0*I8جIXo<7eܓ+ϙ v*G/Ajì_#>0'z>#{Zl5_<~neo=s޲ϓ_5v s0<9rM7lOlN[n2UMISt.攋>3~{;=E]#Ψ{3z>kC?KEѓ^ 9bz_u<<➽PydNz(|ګp)%քkp$̓U m__Ը% ^ iV/xGۤPm̩CwLnɤ_18{;qЭ%aw n%ws&צ . KP 2drjǓ߶>sҹ:#.ʻl+LC4j`w{UvȉӻjgzgYZ)|Zu/Zk*hW0N:戟>6 ӻbpWf?uNQtͤV0 ܃{6lc p]ޛy=, | &~jؓ>˅ ;-|WI~`g$^Q zF::/kJy'X\RQz275s{,X&wgoS+c%~.eM')9nb{rn) :/f.ƓI|]vfm({ Z!V̧~) VBko#d1U-G}lkViz[<.އ̭#61x(ڮIU%N81]v^|خ {U;`bw,;q,Zdb > WQڈ=wƎIة0&9.V2W>OymSx ~Iq'+DZ0WwT4Yna5f+oƎ 0Ԡ},Eo#%| {B30>/qiKbo.ϳxW %-@=fPGoZGގ2z,.1=ZgD n!>ٛ&IB[ފ],;V]XWI!lRݭNS sr"b_NT9alǭ$4[̙!onw+q{;ɠȀ%14tCM2*^-Z#UN4yW!3`I j\BBa_0׸Pc{L|`&juy' r6 ^ Z\wX38v7r{ȏoh0Mmjf#vVN"\%9OY{ ROjԫx0#{hچp@;Ѡ {;Z!y丁LX>!4,sudQoC?}Kw !0%a Oزd27MrWbAlH~EUjCt}JKº^wX7zPۢV dOf~¾NnE<>ҝO53堷G(,| ">Dp=*#&0rk8T"xs# m=75~G~kO&lA&G5zu닾y\6v{u'6q޷DX=KfoyYCz0o=axUo׭-ji%ƚ(0HR]x။uM+^-r(rN~c|֎U)}~{x]Mœ z7s'6[C,k5֠ ?L(mWxGn~>o,;8䵄aWx&(zWh܉j/;)N/V#N!x#b&njKj9֟M<.rOƅoW={>6$wLMnпKҪKcbmȇjsea?p|,ZO3XBoNqJ)aɼ3&ʼE-z\X@ cq S ,2J7f;K?vjo0jC]2_WA).FԨo$=pF} |Eb~þ rU??-: .A6E[7uԜ WX+-s=5˄ -2{X0w͡V={ǹhVX?>3`.@--V275 .G%qVzŧX>a2ORxsDN"?7_z4%ggU]V}{B#?3*r8K5z9;D!_aߩ}"T^ ZNօ/y~R7$8/k+cɹ[yZI^~πa|~Gy*Xǘ>KN/'z.3E}< Sk&UaIX9  x2C& s{WvsZѤI'K|f{wvǜ{&b9>wϻvesum jGNEf +ڿjwyDF#ߎz|vܨԃo-]V{]V!pd-5Ka\ |o=h8.Ffc7jxQ38j+# ?[;[!G7Ss9}u7UQ~H>wvNbmNL e_-Gad0›SH \,Y8zRɂT y /yl#6京NYnjc; ϝ|OD/u#aZ^yp *gE,95iB~2AiHU,"02k#m4ɸErOjǵۇ3Ʌq{|OIJ#sNI>? rZvWn@oЧk#j>xx# @2v:gJ~&ƇrZڶpஞTθrgY9zr@M?kՎ %F>luWͫQv("87QjpqD.jDod"(s[w#=ܛ\txqxqg՝W2b[K,d;9izf]aؠq4ޑoc. atHrcR}7!^~3v1;źHYlܧs@wW/Խ'ճ|{9  zJ&Z P/N>6>Y83J趸)7u@v3F!utډ {ŷ=>tB~$ot DiwfEnW{oR(!!CF&@c[$[K#ْe^Ypֱ3YɩSqF \NT/{إΣah笽f}u{Mٻ)g+x&{ u Ʌ IC Ɠ^p,iKL C'oÛ^O\:Y]Wo{y:g\6C/>z?ңj~s7{:5OcjMj2v#/{OG|^o8|o0eg">7M,G9W^g0"81wWrmp1B0eQ6XʂMGA!sWYl)Wo79@Y1uno\ >C8Y_"n8{=5 ˌK!oxVi >pC'qݿ2O§xvYg*@b$wE7 SOcdoџ3^c1Yd%{]rΣ`ɛawO[~7'0KUww}&|`2#)+<+@ ,KRPW\3EM$78skiQo)x{|费ZXc TKKB>Vui``8js4x֤z0qN%(DbT0Y hb;~cV?kZp]ϊgU%c?Xчn:9(t2V?r3yUy' E>+dE^69s`0TάV):/d9Ʌ }%$ iTc uG"i6q<UQ;U!L-lϙ*= |:5a/J^ 9(.jћ4B3zYg׵lRSN=^> 2b!.0nh/R nyRZƷO/iUɇ`<>1CȽ'Z*=/`$x\G~.$w9w)zs ?Uh#'s0dU>/38{՜7+dI/3`"_0R:pBGtȑ#>lxE^q$`s.3z?8nRs UE80k.Z~[kRǝ# (5Gj8G-i[Ϯ l C0X0!Lke G90wOwB'N|Y F`ŝp9鸓 QU773a ]O ԋdPsaק|>V:zѳ`J[# #(zf0s6j<D\H,)!K!2 XT\[=nV}[VazU#f3Y!6EX<>x[9z(8Oϑ)ɈSKaӰlTHm$+ SK+RqONd˗#Ț@-;$ʀOa3 j =>5M)r}FMIF?j摳~4M޳k!ص<da-NI"q 7G2 5ȧϨTw=ʸZE%ȴц[\M[i#L;;e)%! 8đe[E&j[%_p~N|$ʻHsK odQw)/&A#F{7Q~Oh&Vvu+sHI\dU݂_.q̵{-@ ˪K@Z_y8$sU|Fp@7;0_e~SրKNuڻWS=7/į+DSn ީ#d?vy!V+U2|G_^S2W/u}K9&vz!p hhG@旅ּ- g*,pnϯEq&4Љ8/8'1ɢuP V5yu8 )khD@C.HÞ[EC1)ㄼ3d43̱Nm&P|.6|"վW yN~{e'o_~8q[ =f_}.RWMՉ}ۇ_^zIx, `>>w˫^}H#g9.&F{13YNF$?Y' >Bۃa] sfc{2t`}6Ry4'xDnT=}/7 ԗXK rǙCNecMnĎx.pO)6X ~m:oi n#6 .;CnbmNz/SGPEݯ:'g>'33EqfqzO9^ڀ=}}yϳ^nE>ch Q}(.o^ˈ7za|]Kۙ/Y+ BTK]e?0VC/p=xg)l<[}X)s/Qv-;csWz% 'gxfO)iVn1A>L = kOΞG rv鹜 Q=na/tŜZK scnn~) P ^1C:g7|t3\Dp a{WkxS{"NS5ĺc*;9=&m0i*LC^/ހO#O۸oxw֛ߎ]kq?9o㿋[scic|n d[ig0#x89\s6o;ja<m70*lW_e>2kןr']|}`4+bfC7j2FixG v3 {Lu 50NkuQ~k>M`Z.Q;%<;2G65B M bAmjh^OfhO`A`avk`}Sa72VP`Rw=aÏZ sˆB~8LSXSL '|_;/y3s%Wѷ5kΡ|bq*|4u߻01)ȩIQ?YjNycI?n#[Q>I 1"aɐU+ "_҈K>-I\VĮhȄc#$+C^p'uEsqaJ܋Nmj(*,Qr8Ԥ8v}#nO#a1WJbθ,UBG<I':90!I\#߰[مq|Ha%_+&g(x7-˚gC;Y¤ MPG`Qշ0̘0}dN3σ2-‰#ضۀ"E kPߊɜ+M|:)CsUvU4mGjaMc 򍶢o&TCnN!YX+ ۡ]rԲMƧvA9h} ԆjFkЮlPgLYsIK/oY7~ ҋXkS4#bH#&?Uć܂\ M# sS`<54b`k?_'$n9-!5$>.>ad;{mC`/6dCӆN/؇{,v55akڛ/ĘUT]%J=ٟn"s\4>PChuq2 g]()nfWȆAN̑kN}3yS\ռ%ɍ׽_.YRK~΁={ҋ+/慺_6V*A0/lEl/m^va>QO`$Ҟ!Ϥ7C+0sIUr!r2[X#Y+0po?3Of12zDLa օ==rbl^N?(1"dR;okJ1ܗW=bje>*ҿՐRdF-)',5.fƎU^yK="y0I?B9vOkB.6PF0Ys4,Jݠx:]c{'3's8ȏrCY{my,ڇ9a?O]!V+Qc=C;@,g;1j[s\b==V6b7Pcv9[Ss{Oq`+슆W}:ϊ=[Y Ʊoy)Mo.b&9C7}*$5ߑe{aǺ]v~ė6$s}g@z{B۟0>hi}+^}!*]}Rc{|o˷=.[hw|j*ާp*-9jy '&+ q%Q ?~ 8i51mr>ݚq\)Mֺ dS,)F VZ!?Lo fpX}^pUW|M 9%MeqٜޖkFHuk6:pV<*+4~0G.fբ[[nRr¸x;9 эQmDĵ _eKa\&xjNthn//Thu[3kp^6#c253ULplAiRͫI\\ &."8 ,o" ݶny _86js)a65P`S}NpT9?s}N,h7gvZg/ef*dx [wAZq- Q/7 Nߌ,@]RdD9+~ \&|A**0ptn`ңv_vW0i0a+Gc+ֱ:;ap=B^.9sxՄ<. ~C_D܅/`/#oעoi݊ĸ;gX>ąm=VR|5fwj/]}uߦ#qAM=g|n^=_~݀]ۙc|X pu@F^ vqB7 KdC{h5x txe\oMVC:;G߿?QwmFƜ~y-2@ '`oP?HXl!qD.^qZk~uWx[Z zu2>aDO_`I3j",gW֜[:[!YyƝ䵋+_Wk$KDžq7uC􊞡Z/dꘜ{q-芌6e7_`{,qُcٰtɌEp۴4ˈa ]nqd70b#9;5'= `ߦB/5/ZcxE}Dwd<Խ#J ̽vB=b#ƍ9wɺm=砉%o93݃ӫʶ"D]:M '0SM?{F NA<t@wѭ!32i]Z O[@uss_~0U䉺,P/ug-7$?8iǜc\CD y/(oPxɹO^>~gyB3oӼz|^7׹֛g,7NfZ$)'5sp߯_Wy^8b1;w5D~ =m(vk+W:&ʓP%_̆ԣpḣ!thyyOs^Q<}-.g oywÞX>5F70ȽћX} {wΚ~PǷ!y7ygIp HƻpCH66xI߆V5~GT1ٴ-\Jɗǵpت=`lKo)a|DU+JtVmvs&| doOm`V./˭Q4*dE٠EFc\SA,EpkNs&\gO/GXUZ< EE r`Np.ÖxS$^Q^?fT -9 |$!/ ߝQf[ȇ7ɉQ^yGon;?a>KZdX'N ^l ?#DV \e{k;sĜIԶg聱,ֳj=+`$jJlJV56-}N`>5JmϹnwtfI|ˠ_G/#_ERoԏ:`5g/ī$86kY=0.G}z̿'z@ ȩ?VϘOW )ǼѰ9ɻ\A{0yhԲY1YFu-% _ŗ&EPJJ=%~k/F0.ĂwKd@wn06-Ep]lSU{g^Q #Dsw0^jSK 37Yw!uȇ8#RWZ0p_rG ?cFdܫjد2 )?R2c ഷ1^WOjBygك/^qW7Ք7nԖԏ}C.Ź-^.k3?Q>VNsG3R ZGZf::3خ.z5bCrvas6Ɏ| =?g [B=Oc Qo܄wNv~.{ ڢc' {֪r OE57y֫[]QE^31͍ zAWj|IBO_ 5j`qϸ-a {j]E.>ų"f'}OC k`_F69 Om#-5yc@GD Bg]%0Ȕ />tM 5F<|9O}NjJ-8G|AL+NQj&\] \PY֜>K Q>^l"ڂwNren}}p7'{?_^C97ӽ^l9wߣ^őorZ3*dnS8֗ C>Fkքl֠B Jž~5Ni{?w4*=87Q{y Ky@iKx}͞ZZt7++ t[6;9Ɣa4~e|įuOǸvSzG`E&pﲟCm)/9+MWx#`$rR˽m+ _sdw:,%iR8$oB;;,!;t< ?s9ϯ[Ɂhv綜7?P bx"9.K÷=)O[>u9&e>}I􇙟Z&D?#E\\D?0>D>r/>W^̟5zn\'suC}һ7pkktq-YCz³~o-vn ߂a?& ڠvcF 5Z: s"amY5R㵻:l9&#ן~mt_ۯnjx !6`K֌wULEFIZeI,(7yڎ=8' ^foe.UZxrܔ=1> -{^S}'8!S+gr< 5 W8E7Y ;t^rxݞq Μ5=rzdj{;nTUɻmJĆ:yU#!6F:ن9jp9kLӣJIm_ߠk13+ǥ ƕwu[J}\z'0癰_̄b|hov*|AΊнi]kP_VԩCX19?ƻw]JpD;^ 1ؓ&wF/Sj;neq%;:{ ۊR&|C#Z{Dz|'eO0KKʀou>V̬!%p{P:^dJѕ]G\_qU8o)VoW tUS}TžSؖt 206c PP{أn-`3QdMEr?p@ފԱ{l&z9 кpٕ)>?w زsӜFZ3 js߾zJ&(8Sz'_5%]0[uIæ5pDcљ53#:"1Z7Y'd {qyh Q?oơgW=~Yuh7_6;cF`TsFڤ<;-kd5ac@Ĝ]`V؀1ta@`πoabL]z9 ~׎a}[8 5%G'YЪxuO @>.Շ3DYva q\|Qnη\׻T~/3 s%5*a{nISz?~ c{yMy¸ϣ>h#qur+_<.lWJ|(&u/}goanuZ|ǃIRàQjc)B; le=BVC^p/瘰g:T{zsnNvg3{ugǰ6YȑUXKS/ ff|[ј@,ĖkJh<șsq>emf~. `M3F<{Os6eaΗIJ:@BXB$7Ʋ%/@ !˖0:tw9nɒu=}[xsV~:z9;̟ 񳛙b0w7;Y /NnƮ{#w[x퟼ӝK8ϴQ 0`3ͨ~6pRܟwKbLuwŇRCؗ&SyofbvO~+΁ ?/JzPΰvovr\laoB D=A޲чFjDO8^cحaSoU}دډWJ1u9<‹uaVKs_o[O> ՠ7`:aGxzPŷ߄./)s1jܪ]}KO}da-gQwzJ(`'Ґ)BgD޹ˑOUhWK0C[xĮ²ǹA,VXdӡ0A^9]dxuQ. 6XQ᭞Y|.TZ"I1i9_W:]_w A߷nM\3 MVž N wul)j%A_O .pa+:E[V='b"4>ܚC~{ɫ`P08 u_^u=\veYn*9IbE'`E rsui_R8o}dYCFcy{ɈC3dgIظ%=#"Э3ɷ>cq,zU@ B5po-q}$4=5Mի *õ5E>}yڸ `v뻰S~7T$Ye./{$wM6o]rLr`JҶ|y }>1q$/6f'j:5.aā!=&W 3N^o1'Nd+ l";YWtaekg` 9h/xh~c`Me+'mC11~.^~~3V5rk!o<ˁ*)RPu,8~_Q:Y2Ytb? SYBzP zՀ<d8XdZ2p?O7%`#E֚rs/%ۅcn]c-O>S`>֯DZ\ݑyGaj%_`M4n_ I}w5UYzˠWNi|in]}3!8- b)tcdl|שŕhqZs>ZѪ$8#%W ryNi5`_K3jl&x\b.f٭DF8 ~K Ba~Q?!g]I鵨4 sohwTcZ;Gdˠkȡ2~Pvm[ٕX']n7fu!geucު3Mt5m_WZ,@-v2p xo˾Ze }5P31/beΓB7\tG]AemZj 9ϫ1ZS:v-Skah⧢3-]إQ[LpfR[s-HsԒ[[|&'ςsp $&F {.zEjIjrԪBӣ,}77NA8|a7( B;1F]yˇ!ϯkw X 3ov|zrL!:7^K<$nj\!ɰϩ>KmoށNg}yMΤvг{3^#{GrkhwᘑuY4~ ^~gjHCc dA򣓼O/ow~O3#AC#,NvS~<ȵxtezܠyg78pw$vjBy$ֆG<"MSOi0laOyV8Ƙ"d)>7c۳}gp*P٩1e(#w/<!_zgk`1OޢYi:=VMy)䂿4HaljU;lI3vޗA7!=FnC0= fdƱ#\h#Ԍnr"pSxWl?NN5׹'=:ߝC|Ŝ`HЌ⨏ 9E?J=§n5c0^<'w}ANvGm/׼~zד}:MTMz-Q'9$&?_GC7$'?gCr}=&tY9;+@|G&NqƷs\@ΣfEw%̰/PgH8G|ud}n9{!q1E G=9ܴ4+pY4zGcs)5Ot6aNtfsN9lȆlH>`#[-[mlа ’eǰL=7zߏ;Azm27Bx_Ի z1W Vʅ'9Y]9U2^yn&C^iD3n~11nۅ_?*ꯟ2$i z̛`ˏ4BZs+VxpZ(W/Q^6gn#pT=1;0+eĵ:vwݝBXs@ Wa?ضȁ40+l'< 9MdPDލ< Ӓː ΄fv* ]%.rÁ OU|ϾB b,Q͍Zf4("1UѺkjdi$fbaSlCW`#-q5\v 'z \ so'.gle2U WùеyeJj_`8V ߨk >'iSb\8R3uaSx V\ ]'{.~>{ZTPy\sS~䆮Č)kFnKvF,ɮs"|\%"]:,vZuLCCȯlP%6.p*i †IjW˿q&jQOn+7?n$z$%3؛]ɹ^Z;SaCvyϪjIg:Ew_W_}8s{\wv0p ʾbXW_;][{ꂜGmf^~gЩ'6+/DžXuV8 W+A$,i mQ{V]eU.2WCàY94r>Bt5a#\g.L[Yc J.%OV<6a  ^R;t<=`xo7V3C}E걟OV#5ݷoWcz]3Ѫ.-js^ewʒkU{^^VA vhOJZz@'J ~{j.ꠛz$<'i5¯4 rܽb.M.o?M^вdLx0}Z;4S{߀ngL@]HmўYzV~@o 0U`t܁6W4yT8 8#ZѰ2EfD#X~*udUQ+ a4jChs+?Y& 72N鑕 [[q2DdjKhSjc2cBͺ'A ޚ6.g?}h%ճݗ97;` 61X#Qw/y]QV d^'#}5x!FQ;r(fʹ_Q" /eb`,r(}w2RhJhl3&WbGNZiDY e?yq.McC^ӃLhʊ2?Z[3Oa'§9z YW{+eoy=җSl̶Ǩ2dOX9Y.v'rA6{c?>PyŘg`4V%}ĮB f$y넧G0@rKӏ_!5JGuC~mI. ?ڎhsu7>žp>$^t=ɠuɏ'(gprj0 H>!K`RsO爁3^%6Wk|k9[:c4\1uđcM,`>ege73\eQ=e{Sd\r2娜)#MsS? Lig>BŚ>'e[ō".$W9ӏ-NytI&Q0 KMm gkVCY۶!$b^{yڋe}S_*3ˁ#cas~w=w%FQǞ !'o-yex fo  *!`*oa` r0e7iG'kH̠#-0rͱ2kcL5U?y/iҎ5{\YYl:czcQz鶊USF=tBN5~$um7j^n=%b6@2_'\5j_n5W_=`j5<;'o;L>$wYVu?$D0MMWh^d€ 4SMȍ;Чh1OSZU~6˺\F'C~6iAP f `iif:LDoI!;eFVs̘=N&68CsKS뢽NF/h8u*daLJ2/kv­E_gb1xFx }E<÷G=hS[U}1.5|$6fzO Vuͽq= } N;yWƁydYvso?s_3_ֿW6p{mV܆ޚsn7|Ku5ewLzLjwr^_[J,8:<آc-_5`,$V k3xm^x0v tKbu1O &t\t9 ]p"Ƣ}f vi7wg9GN7z51U3ֽea)e X5rA9'-;G{K~>-ys npNy_gcG+=Qv?Ggri-Ǣ`J=jcY1"M!oVb#eׄ}9^wE,%J`bE[n;v!役wl2;n/r5~i|y;>mfϛgͳ\?[w3?ه?`ywmaK6F摟xāg)835_/2_y?t5voJ"+W#zoubgl9{9ΠNP Oqo1x_vL}^eF!%p6m#h7pvnwS*@'k;RMPk6̺F0Ŝ\!s3ia K - $elY !%ٲй yO/RշW; 5';,=pї] }mfF=cPudSpaF)T/SAj>Yߑ?R| K{OA½a׫V@ ׎X z?x}~)A}9GY^$]ą+9Gq?&36rN9ܳ+;7%ͿGCڌۥO8k?7JԿ:S-ʮ=y,mN?Kz-_%KSz]zzC_Y(|/MQS=-jQ΅VF+9ru)c3yalPY*Xx#x! _vUD-U?`ns2P< բ2gx5냏0Q͠md[[ߔ! +н-w*9c :1|(:)s6tvPϲ*#JNzK`Rrp/|oͽnr{OhZ 9`XX !k.״K9&)0!ۨKߠۂCVt"m nwp^ jc xV 6ɇ[JrT',\|<[=*<7Ֆ b&umFJF 8lWvn+`_ĥm^y-w~|3hU6C]p'`Egk^횅9y2s[3j%xg|P+v+U{(c", ʎRl@=bK[_](qVv[-0%>u[ aӐoYR|_}A *2,귪IVr &gG~<}8M7 /۾y}/QN~0ЖˢQY;<SZSyXcLFڡ{9-C^n("aӳ*^5y|l:<q;=׮le;h[Mw}.[m:Qr[; {-- {0gi/v-ڧDcQGjfՆoo>xZ|#kFDt˪]ghcy Df)Yoز nk ?\o׬+WW~Il+xw=jopG yoAyFqYBk\s3J 3ˆVa*bX+D hqi|̃ӢH ZoRK+2sA#7\cDAs ׈?s#5*C_kyӉ% OE+26VzJ9!S%3 J!Soԩf|2IˍC i0K] ˣ?/c';y9am1uO?'+ Sd~'ˁ] \8&; `|;/rf=*3{8˓d\39ƺ?kP&75rn#ˍ!|:NڳXgԥlzB XSҷc8/9!jTu+I)ԟ}n35,}Gc;~^jJ!רqfbL+Ϛ"%>c8/1p45]'i+ρjG$?337Nkp3> ge+=o^Z Ls@`9lZg8o'fi'l|ĻSe̡Y)_w?FFGO3+J'Ȍ|%F}ڙL~OZF\R-$Va5sJS}!IQ {ϠӒgwҋCWkO_qQ*-ޚ"3?^3'6{24T;9#ef3d}t: M:.Ѹd!MUa3W Zl&yxF½Y) qѥ[. ĸTW:כ*F--|AV!)LP8vF8a9b^o۪^ Ue4,1"K ȯvkGS؆<;Y4kLwPM^53[n 9mamXzU>1g:pA])z8UȕeA-5qn-Cr+˹#.5~ȉĥyuAM?>5,ªl^E~r+Efu)sKc-|Rkihђef7On+mҡ/3?U[)w̔bS>7!8T;tt? pydR1k+=*8/}'15qY#Hc]C; ?$ޠ_M^)I'C 6X'Lw};KȽ|( KIeuCC̯ny?CNX=#LGT&c/uokd4}5RniG˽ wldlGd,U3 CfX&k7ds#̲ܧ6p_Y< uY7:lwT 71q[kZBcjCMqm4m}-[ԥT c1،-#Ĵo 6MryvhldF|zذ*u[b y$NeW|g,Ķ~hy><{Ž+qG/?5}2&5pkLb=s'>Z!'ש۠RWRKWh kE4EhS;kgA;7&)sBvm' ckmMҦR'mmŤ3Wq=蕠k[«<}F6n@k-PW}]IpUa^~9p ϨOUNuu!2݅B̅sc~=dm-B2 L 61Y-c s>w|7/y"Q[9Њ8_{IwmԢSٖcx}6lD;xRiWڰ"y¢>eI W=ց.r#[_S*=;y@,};-* p,Yb}L -8}93-/?AYQ CrMÝIsl07)sav[}glh:CI;u}rqk~i\#pڿq, {\b̵ >};q\KfsɡS7 JG`Zz3Q/yl1WFi Xa*O=.>OBf?JLNa5k+'G]UYX:` [ 2 b>vv]5=?& 1/=0Epοe#We^SXLf댱>_+/۾[Qr6p_8"7t[ꪛE\2u= ޕ/WC8W>Vfwd1/ԗ%j.h\ym+[}pk{ ~ ;퐌ϑa=r3Fv^}S7Lhc\`^;y$}A&o9]j{r?txeb5y$XϰGs2}\z'2f8&=CYUcsE/{55=fDnvu)6>fȁj_w>?hN:b=u}~UsܫM9;x,gir-*~] $Z "X2Ć~79BMO:I77Ad٧cCϳz9'w_I(g9)\E?CXwR4@)짓%uuM4L|Fp?9{!^cIo{D38`:G=1Ϻ>O7\zmT"k7C6_ W9`fEV-m 㱍=.oe.139֭ê්45ςA>VkU| Cj U$ -򪰏j7f$ȟ$C`9C2B6pa2{ >b8}."J1)Y̪nk&r Yp:*Y_||df͠!C (g:d檢?lƨ?CǦNvUԑ#+T3jSb^Ռe5pLYvxV1Fg̚F(+T5؎$YŶZH U m'NMbY@(ڕ'%7V6ߒwA2(7y.-ܨ4?aJlV1- *l ~NocQz[f$'OaKWv>->_d m<ư# ƄyȃS5}wډ7}#mɯ`rF]ܓ}r<;aͬp+|:Lfҁ*;WV%q֬#arcj>XjBWS!9ҿ3skj+ž-! NQPC/N#4m3W1m擼ԯQj*q7a{JVTgn a`.,]lxu0[3/F>ԌYk)l W+bRJ%̽!i53y:XT^!^>2J-rԜ&d[5j;ߊ:7ޏd//LnTWy͚nSl `Wyn=!j ~_25ψKGDoS5X&^WT;aZ_.=V 5MԒ[JةKo@V _脚* \c&EFt^_ܮ8*LOBU_s+-#gK,x"zW/GԟC/ˢ-^ًeLb mt P|>6643m}G=YA7w^~ %|'A/uQϴ"/!X0M΅-` U%r$mzt#.%2StM}*7~$ro=/ d$XNb/~9{@a pZO_݃^qtAX_ KzYEp٧sIS?~v~&7I/ѥv7"MzU|]Ë)YnnF-_?}n+pa' 1_֕<#RCh)nqOO除nfsz* Knu?8εWG)ǡS6ok0o{1Cxgѧgn*0ks@dO3gJ|5Cy]~,j9Ή8#;w bnf6:k>"1`Y<:Dˈg'NiECbsa>~~|2h8(S{S6F3ItqnЁ>Syq)Anb'=;wkϑJ4tnIW{;ٙ4:Qe.n \ϱKje5>Pk 2O;~"Cԟ:{7h|Q"Nk&e:)Yg ,} ;kC܀;}K.kR3CŮi#e~m] YE<'y3S"[ ]68wв1ʹ~%^~0.ͳ~b3s_Wswfxp:<-7~G]D((F}{'=)}s+sI_7굟[ĹNMUm9ABlθҧyNGNq^g1+7lGtoNF}o?$q}qy{J^y]֐)?>+wՄaٿ˺> 0Y78;QtjŽs[&hX`70&d D!I+3V&F::gg+6l rcȠlqoaF̧Od5oZ]Ke~\larM l== ,37n\ eN=cFN|N;06"G*T./@oFg#ȑ'r`Ŵs$R!v4~5ӳJ%yeܘ3kFLNdOg}ڷ虨ɇ#Ai>X.hs)Lx5dG1bE.D'N C3/0#s1 ^b@D?'ϴ@z3˸amڅ^T>Gٰ+chC |/&8OyxOJ=>ơp !oEց~35辌a*vzr ȓI-샳1Hg1( gܣ0P1*85&se>Է=hLr$f(q&vkk xěW3I%|\f]m#isr椗&@,f Yw9=}'eK \RJu$JUVUsc+qe58KF!3&܋ Z/YDYkJ9r$s MF,.kc^ cɆ´v' iݺJ) F]ȒC!2uC+pYMRi)$&80'}fٌ@3+.X븳9D zv`lc]Zsa-Jqw>ߥm?0c*~Hd5k s!.^il&5NwJ0,qLO+.9z6J `XywjdTBI+T`scߑoj;ߙ&j3宷[Q= ><07a`E_k3cl=89VyVe뗖ȀZnsSWsެUqv,`|r!cX*V=۾S;Ƣ\xV}-cUhݳxZPvmglgZ<͡[\CFpu)v"'ԏS^(/gmny1A@p#[a>tKԽ sڐKp[ }e21ZE\[yM _"s[kAZ1V|ܖ}\,2]=A5=MU];&LCk]RJ^*=4058nv9,54{klrCeǷi{2+E^'˪UNv>|B4 w;}.V]|}=Y 4lNnf.psRUxy{97\a)Yk_j9 ;,e6bhWZk3ɔ5Q [JWB\8̤xY#L\+-7e?~o~>q.م?%݅gd}F;3ۙ'/na՜o/^rwl }K۩W8ʜ_rϡnD&5ٿbGȟU1X9:6bmqw S^]k ګWy8ϼ컐u=*2kV̿j-v#u_KQkYOj 6躭,Q0~ S{˦ w _r/Ε)O,~ W] 坟a U;o-7dOA ~AF 5tРmǟeL62 9Yu(+L,@Q5_6ړQ Z-+ФmQa(SG$+»j*L; q f ۶*UYBHsp;q%!m~WMLkrWNnM m>P;SMM{aO,=eڊZQ|y2|*y-K;m4VxMkFUe2@̨\QN<7*(dч|)[34kQ8UԈ%yIݠUVئz:w(11xBZr2-CA}}8)kVN> )#jD3152W7fVq}ؑ#%nF +in֝\|Q%DxcRWν|i-^Grb.0sX_x֩S ֏tFJ +!oXw&U#ۍ8kNnh$t]6P+P!:0v':̒{0mC>ȇ\'!~c=}Ԏ\Kܯn=I|bManpp"kw`»bOOp ]C"θ/4lr]6~<ΩĄmS9ZWpϖiQOn+#H$C;I_y?ɼιlrs>aC;igg&@!%  e~[Bvi|-˔lER,>0}ë|:xC2g4m,tG}:i~P^ K vTfZԶaIo?:{,0с~Y2jx EMgOmi ğ. Sۨ9Q9 U;]v{?w&E3tP"m6iв uXWںWk#zP¯Bl?mp:Qӧ 0wq?d2d[ۢPSv;{FE oXRHh+d2=ʈv7|N%" Jb`gW;"{g/=Bp x {F , _w ٯ3D2=qF6'a |K= [%p8¿q]N ;})_jV4=XT9؟ @_ſ5d0qK3Čgg}Y3 o*'|9{1%{5Z㺛``m=9[Y2u.sg6Bl$'ϪQv'r`r/|N{{v%wχU38?n?θ\&}#yr=f¾WF`*%5#qg'xAsp^G=CM335ꜱVI2%jt3LȔ}O"FOt7H2̐=;Spdq6"_2}|溜fx^:s-1k ~nqRO"%z9OLy^D_|pYr~M'׊MAK|zZE?[pܺEͽq[G β9h"?^U9/̡7/˼rJM[,ʽAE }%"sKgKuݹKoXr/:=4ƽ'.Lxxv̿k x/pݎ- {FSOs+[KcI. zB`'mD C{ Ewദ=J` خV iW]2LZM#Uv}2M$[M*pe%L2fCPBM~jINql?s䦙kUі^9&7cn5N%X`д0,T6ʀNįM=4cZ=M yv3_7`Fq) Yxjnlԃت g!a,arI"l6#|eq*;$PGԖzXPdb:|>!{`[O]p%j?اt 3G Zf Y ^@,PW LgR2Acnwc'2a_X+6oRz*刹1X#dRlY-\π|z=Nx`Ow̨rȳSByqE|%g؎,3_mnS5C *BC}ڑ7ƵcΤFK$c崱df&伓s۫*Q|3ȭa\ s~K;U<َ#χ䶰 O0W iHe7 |;EnJ20 Y[ ,8M$qzEQCRYس`d.̢;RnayF]Vsb?g39BHK114ըKTƱ#Xq>[V^9&9chuすmIacG]`&3ÌPvF ۨa0+2#d`C;d B6k~&_(~&T#_5ߩV"Ao딓[[9غu5ףq~AEM7^,oWիoBI!^ԫɝKJJ;r}j;lggg6݄\H_-[BMHd!3idҴs94VQzS7+qhI-![pMѭZ3."FgWBC"%B)<]bw8=IĈPǖb03˜b)@azeQ8\74758X2~^iw hMj|j>ǬGIhA??k&4r).{` ͅYўV>G4yp53{gAдQQv[?zPF?@mYBXU),:1pSr$c.\k3aӷ>d&.pmY{́vٶ}{}G [H*~->m'GB#;/ fn{|P9l'ֲ(ޕ _@ָfGm˻?s~mw{]}♥igꖧУWXDmknpDܻvrzc:}h0z -3Rwfeknxf~³ Yc{-蕖S{}uW|Gb?3+{^/Ӭ {vyڄy0nky_ynBxm.IoU8'u9g;&.4j^<» }yeWAysbjXWng2~[丒MKz{ˈމo-]]]r^S}beYyX)4 >EN_ٛyu0<gG'!⽓ʷOO|w}ⓟs* [9NOdcxNRsR-rG3>t!Z?d9`;SJCՕ|kVe_>k` ;XᱶA yMk<: Ȥȥ6Alfm5z# 5_?jV|Ql+縂g:Uo*wp)&#ɈxL{v(ÆσS긣e&K?Q_6z ՔWɭt`CS4 ]0o'Y7|O({7\̷RӼg!>C#dN7y\Kj*?  ,G`*w`OI|oeg7%>N%dB2.X\SQӆpOb;kAW?4XbWL&8g ,BL\S})0KCz紋xEjT)F_ra]]٩S4.6ay6ћjTGurXdd3mms5Ce\ie:ă€M]}2$_NuKrGw}2\Yγ|ialvհ WGƙLzYK]ikX/*bO[ zwVɎ#)}R6)6Aû{Or)kԶGy@G9(H GcGs2'9F͋sP6fXz@kPCikdg5V* -hoz2bՀpuɫԍSݍYPqWG|r_7rt'){N;OŸ́2[WFܕ`4~)⫑]`ޘox&Z67V7KY $߲gsWV cxҲ߫=UfH$+Ppocgχ8<4t\9tpeuX]d5>bԹ#);އMaAĩ{ʮsxf8e0Sy^9ԐEa"5=M]W]m 6ǽh;3htaʱHPsl{8_]%獇]n m,X/D?qvZײtFE1APDP*&t: !/Av]GA$̏#۝~ítq{YgB[<}kSh==v <Ǚ췵%ssfN gFw T36uKq$y|;9=#p pc~`u=W}|4~ sdUm ],L*seh 9Tihm}Ե#}7@= _Cg#F1& Dn;:my6"`ߘѻ| a`4bBpNH΃͒>'.rz}< 3&>@B8 eoK><LNb1ª ȎM ߐ%cC\ euûOF:N8GAgy:5G1naDG{zw<;2Nt[9FPF3'Z;V@ohg0/(rA~4ã:T=k`Xóβ=2_y%W̗-??/+q(#y<"#3s:/O\*+9uٵW}_;?ҫkwz?J 7=濁bSqyc g .DԬVg;[ |[qtVՋSRKmW0OzG 96s14"#}k')9\qen쌜3֦&f'qSdW;:=Pk_z-mұ2ʊ?XSgyOYAs Ncg8;E@=^@mbNS #ks J=[ciSy$gvtLuQ'Pojv_fe׬MĘ48E`NҦssHyS,g?/~4N綶vvnmG`Vo;vp{m+~* /[ 韕job]rۻڮ{nlA,(CMYd}j`0f^KRc` o}cVg268Ӣdi^βw5$e _jH9ҭ2+*R?#g+%aǮ6 v·; eV|ҙ3\b\+?grȗ,8((GϐKF~` lܵ8Wknlm7/+srݠ S?R y V|>D2c;~(yb嗘ȕ>o9ơβr/7j/U;+ ^]amßZުS)sw5ʼE ?wzAv d^ z~Pǻ˰a~=v"|ҭS{kk2rz՟S ݖ Qc9!OϺ 7E_Tz)ZQCr`*S6`ߒ2K/DPpf<[XnD|Ҟvqۉ#Pt vTN;: w*]Ca-j]gd,;_[!Hjt 55Ls!'zZ)l$w[ѦYE5ߜNib|E SN000YSb/Mo3Ou z_yTa/Yτ6 ca?4j`UuD1c^}c3}phߎ>ts`B#+XY/ w`aLTq|Mp#C8Po>w0ǵA_O?\8?\' | _UEe ~K۠Ot>aOL*[`Ř!_ C \Yz9F̈Ix+hzFr<;r3,AkV:-Nb=]*^{]OMciDaͳX7|wO1N7xFvG][N),+y4Yy:{_A=;>1GN<qY;5xF 6jneGlo'K{FzHj_[u2yIFyoSӞo訪FfCjүiυ/'rs7Q|YK"xƸO~rV6x y7|[tuꛢ}险ar]}ʳ̄K7gyFg\4VJO)0{|:O#^ec=w{\;'\Xe82NO5Hç 8{.1þ/~5ڏ^mYZȯ&ǔAVX7ުGR~-1F sq%rf`σ;=KQߎ h)k-=󟫕!9k;jnmg^0%禰.83U{MpF7y?DX>eFyV{iF;XEϯvVgFzZ(ҋx^1HYC[8cȨy&3ZIv ?{-8䏮]Lp6BJ)y(Ζ|e"ƈVUԞ瞽>;cINk޸z {CCS rg\n`!>)EGK MѩА'=4Yg[!߳>=;j&tcYٛw>c%0mma#{NNwqObk-no9{s˭uC仦Egò'#nݬ0Sx2K2*̵Bmg.g~l>?C?Pc߄>OtYUvֽ(lW?VګW?:8f^?0~R6xvǢ/w?Gwo1G2Y٫wuE-jGeU?:.vTfk$|9/zj'pZor겼xsp"& kz9~*3 ZXSi+s,* QwJ Ei"Zu^{[bܻ{E>**8K]ڠ&hշr55uh{ڇ"Ns{.GvB<]) 'KR|gwd3a ư00MvG`\憼uCˑ-{_ɡO|SH_O_V*G]#[f&6nr>]z>mя]u+< ه֖\Ѿ)(;yn5WN/P2k=!0,|OO8rdD =rbi|=~+~C)d-ŽキBc3¶|4x_$GW. @?;[Q\A[Х;!~; ),E=b/\e?;רj!̬Rm~Vس^BQ}icO0)gyE<{$^ɰb0laT2:jo9kryR`N YG]g/.߼ʭ3qOZeV_vqd1WrjaIWA9[20u.J¹E[aOXO2Bz ="G9K8|gZ~C7m NN);K|B^$)p}C<#~Qbbr`ZU! .஽Eu&ye]0k݋M5iᘍ1ܝj qïYڧ齃UPEeEUeXtY1>GZ:tS3ѕ68.֘v~^V6T:5y.1H #=✲vf]k{딕 S[zVVqySѧȬ®Ě0+Z=kk܋j9ta[3O1c]:0A}9- F2sGt9:GUQ!xA #&L['$m Nv}~IRjJm VkTum߂ޮc𚰽+n3|h[\z7j{j]W6F{WWYFa{~^=?L_UBP4y GȪeG Arc #ϯwb,`]s+~m6< pШig%'QrLzW.U[ F,pҟ?|F ߅ۉǞ'<?W AۇG-ѫ6Tk&YEq.@M>|4wP7ߓΏ"WF얲b7[1Qz>gYz157яs/ }󖙐zncѯ$э2kZ#7ŊMh+@ s;Ϗ0!8ˊ8`GVnzoyplxtз<',lucApnx,B,9j[3cBU}gx8tg`G OC;tS~oc923AUs鍼wp_ƘprӽV;klmT[=IOoU3|>#V먿5ʘjAY8xo>uϝEz쵈5YWI?.Ga1Xղg+sS;y5f} N:yp}oezנi6`iIطT+z=Нk༊`'Y=[;Uݸs~W+ I>³́qqDwC˻ak.?p6`ߛWڷr&=/\ǵ>sk[ӪYGp^hq3$7~e>nݘp?pfǥw`eӢyC~̓xf^\DVbUJ{o6*ax 46x\ԧm^)U{VYH4VdЁ/|\C #bbA }Ku=d3Hy3!È9d2jga#Oy af#c}6 L Yv*'K~ ̔ƑGri> 'um]8RܜBxH/i:-66I>`l8̸ rI|K;{7ۻ<È y ~7I)EgWwy&üg}&.{gԌv~ v);/?*069iLjF|!ʐC|z;Ťndrt`Sx$ɻݭ&hST〺-1=RW`X]kdP&-LWN [{w#(&\zR`2+\D.6 /IJNpi/Qe.zq9CC <Q)d$g ^cU<}NUF;1*?3 yk;r6_({_ _LnǬ%j/%LEusQ+It{'&5[/!A34g0Aghv K~ޗ^.i=x&N5;t4Ep'hpgBȾ'`.j oT `>40>1Q_]\yڏ>*8pd\^a{'|/P91SIׂFm]d31sEҏ5u$ -WZ>En3@=-sGX;yBOɈQxB "J1y3m)fjz^ndGe '5)h̔.{1IFACZYpʫcɾ>YԿ?,}ի&FZοU8}ӭ#CUߧЦO-hZODK:)UKȤ6ωN-dl n;Z y^` 0mu嵡֯Ův6jXu-v zv|=|H!|o&&Vrjl ς.lsγAmp.t1l$ɩ;>E[GG|ݠn'ÂAaLSYڭ)ת)A-DUKHBN t-dtHB7it>j?/缗u|{Op9dѧ?>aOE7ɚvI_sKH_g~f=C .k7oX~7}e:3W?˿ݳ?Jb6s,{.(;E.~:s[dIaѧ`fN8}3.5C}k0ln&wT?S]hOZ`]1ov o/[.rخϷK~n_Z*u_Xπ2A3sˍ)HS M ՚Cݙ(<>¨'-c(l$th? h3}A+uOVx(kRGp A^U =3A}SגWN܉Kj{MqC7JccRCⓣOɎ/_:JA3q-p='g=ID:<>먿uE|j=ɚ4ULGֲ&7Sy:(yPEl~#qd vaڦj.ΡIcaXo.t J73GKv؋tt/yh+~y|0n竜+`Scyխ{rQsv˧Ρ.r?ѫ\'Ēd{%/ Sf&k &9p&AhQ/@8r38Kѣ9_b;Sehkvnnp/NsXd^{G|w˪UluU~P{I^k0fEkqUMo}CW7t-poȮzeYWU׵nZk kbx#⒕ ilK>V+++[6$2*BLX} +m)ekepbYUy pG Lףּ^WW3ρ`{~v%ƐX8kُ1-J_M+,RRV/`BX1rğK WsKbp`eVbӡĶ &-`vJ}t"m #Fƺs'p؎#~!ʹh6W+Ŭi?o 0 8QgOA~cJ(  ye#X 19gy<30g |]X `E3hf^c99_BVkbܛ Sx9|%;FfL ?Yۜ8Dě˹Sh.1?(fr!OQQh7:O`L{.s{YYK~.'d}+eК p#}7}e``bmh1d| =/ &e^[Ef}x>)&.p/(a?ne`9+&Dg s)MCKXcՐzA[[Isģ}W$#4jj[)x˖zy";_ sJ j.zq1){̹Wa?`մګ`/ƂCة*FuV9dQEFAN (mYSxGM {!Fr5YO4v]r>̗#K#d!05WCqgѯxYxO+OF li)aYQ\4q1}ԔSzy5IT2ɡ/ϡ3:, wG0YU|lZO(>ߺi{j cQjaHa>U8W`?aÄg5{b¯oF>Zaߨr&tRAGNqk #݃hXC\7zyϳدⰂj:fQ~ {|u(z9MfɒCM+7-{\ĵIAsGB9Z s0Ξc^%w77ݑ^ѡTQT%w6x2k><^D-U3z3v>AuYh ݥ]F|}lγ{,ā^U׍> z)0q[%KǕ{.KuE}xg3֡kM=ޞ>3翿:6>N%a[@zPlH_M]{6m=a=?{׍6h6O׍y`0{N0|C7 ~Gb/$yee/\/潯k졍^j,y5۩n37\`GPĨ9c8\ӣx 彝%6lj_d癎Pv ϞGt5dQ<9v8p 1Y- l6$ m 7=0-U*aLDt4cι%f2jʼy͛SU5|S`qY:Eu~n&&2*N%M.mF rmߺTE_h+:Ȑ?И7N!ȑ8cDKc] 1cʀ1zt==)c_A5;[Z@հ.ؤ-{Sim-oc,DC8tRע;=zNjAՎti^G~ujpFuxM'subvp[W_ۣz> twWXթ1|e>~1r.|ݚ9MCxLK]`}@!Ϙgoa>mG='_Dl {r}XL`c-~ qlFk>k=XFU3:xagpnFgݖ:S/b9%K%I؂5' c_A,)1Pܯ>{kx"YՌK.+:kqogkC{5;1m/Wj<η<*A7Gճr.󣑙Pg!c|2֪5խ!?ҭcC$k''%ŵ=9Y33nm+݊1||]`0uGmL'P?R v/wKk? !Op&iSS]:0 . ˻F9g2_p^0x,^`=˟~u>oþ"|Kw7Â{i&V]QW|g&RI ~fHRI qpnMLߵ|Ƚ?/yeE~@V;?A.LeEݎB=.2k3W3[n[!ObS\9ڹm̗MyB²CVD<0?/HnS(k$?嘯9c˸V'Sbb}qO9M`y@%by$wOoqό%Pw #x8gVmrOe-TvdY G7ˌώw6xh 't,]Fzw+2/Y.jKh!ߴ=9j]B^ ~3ů-S縦U=.l}C~U>sqra__r{\_C뽵}~# { X'(tk7rDZ+gjV?ǰ*˜d)>@dHcvjj3rs-qZm/Yacs ӿ+lЭ-S_0ƪf|bj_a_NxFpCM^,;Gx?N=%~ge j6JON*{W00N=̫Ze 0M x>`w__pܢ7%˜t+:Yp+Β'i6t糷)0qԝBlg7}r y>c录MЇ}u# Vm[MZ:1|?!ϧ}' S~kɮMRiabm=)66ui6g|7+܄Sih6Wfp5~ m]Pg3[FQ_׶O^EjWбٴ5z %-pƏ,s#>o@Îss+vƲg\gov̒<Ϙ;bXsB4]@͈(r*r=4TώiԖdQIƻN|k'f<{My sMK7c, 06AVM!97Fp^ԱlFbkeB^zRv |B_77Az+|שnEm(c_ˬ$qb"f;lw01lK7`3ZVvlptےV*v?πo9DCFTYYw˼#M;rLmƵs6@e'9%uF$_vxHtXo8_m3=jIjgG~Fm؈xma/u:1N|.Ϳד ,=ǂPF:jQc^;:,>c^X;a׊'6F!mmD;9{΂^jg'=>(-8u'Vwp،}`9ޙvmK,k92;Ƚv3Ϲ~SY6ߐ⾴4؉uPی:ȸm2c~O&T'1>_8' 1N~/GN_gIYuOur_Nq=>c2%~|vHS)b#Q:39|V,CS #9{Gd;"k_OۢI9a,5:vCYysp.+%\qwJEpBYQrHn"[]T޷1x_s+]2n6OtSdea8l@< lh}wA,ŬQ[GEP[{`ww54İaAԅK/iXd h̄a{0G"D|e} X/n{w%Uаie)6K#^bbUZAޯ{΅ئDB~4coFVu?!'Qnr={2Y# #UQKs 4&l*%k>#vI\>'GY{{snD5 k~ *!}p1 ~kW23f9*^bjĜ6{f|\m;&z 5eï-nrr6&Y|TWl+R&W*c>In%c]r'X m&KYg¯l:XCoM{L˽<+n*X nW`ce +s?˯$ s|1/4b%Z&5ϥ9G[œEs;U ې{3,1 AVoiE?Ʋ0^7dȚhEBE<_},K8SF C1wI3pef9ls"S7c_ qjuc/5aqn+rB͈֣Ҫ@q1w AXxo7KKrq@36vĔ}:!z<#kYZ_p6NkA?7GrA of}"yş:upm7OzImYF< ImJN=cCz׾x->3œͨo+l ߨ>%6A:\`fEcU 8o, HV;âM?=\3z~_F;(WcOK^ЯF5~bN]WS[ ,z%ϐY7c0#p֤0ǺՃk{52b8ZMhZ0KvbT<]_?=էȓu/W6{DM'63Ƥo  g |6A _'>c&Ӈd׋Xk 67VzDu+~ d@X NfٵS#W) =7?o3K_ճxxrsx9|JvuZQHNbEnQav%G55bw~ɼ* }sԺF339MbFEe]2ΎLy><ytdH-M 1^.,e"j_Gn qaiG{x<|=%k2sHbƽ@[qpn{::,h3܏>s]>@m=|s{Eοݷyp 7k3MEbgkq>[[UCSl䝪ӍG\7]-tcm{m_#Aրڍ[40MRZ-:{֝^^s+f\)Ӯqg̕k];x6Zƺ^-v bQqՍh.ק&4o;ڭjp\wQ( 2%!! Hӹpoêd!NBϰn;zzDccsq}C:Vzi.`}' =YkS[tèC8>4H@rc3ЍAif2'o#/3"GR?̥!AHmǚ {H3Ow\ke&Q(k%Pc[eqX|m=㡽!?0"72o2$5Z>&C5Rjc[1{^;1܋caWD4߾F{Z6ƯzRY~]oֻ ܿw`÷r+xjy f,9Etϰ+d+02_VE[r/!Cv;0#Aa?4906` 2g =tIyhpEc a>Ew%aR<;ᘢ쥵{`3hyw7?Xx{":UW_sXA.K:FZ[V֫"i#u77-ٱg3l]ڟ{}}sCgi/|m '=^Ps|N3dKtZ$Z^X29Ya;Z?!Zk0XÚ<`\_"|5jiW캪a|qu9H;l;# N8/9"R--@໠moJ_JUW963r+;OJƀQ.AznC1n0e)-ki¤Vk2\ʼ=%vɷ`f1Ś`Sm}զac}ɞ0}Է?5iQ"?NR({*`9pΤRY+)˶}:`S?ȱ>'bJ5 sZĽdM#{(~&e~?ybs_4TsoC!Ѣi.Y\&(6)8?/_dDT~V4GܕU`.U[9U+s~L ߫B./(mOϽ6OO #z\U]}N '`{tVj%shY)Z1\Pf)+//vTG?״1WMGrn j gne Z5XxA[JjG?ú j'}:N^HCr>K@C S/HlB;S+)˓gO烧l¸4/:dCCE=Y\^kE4%P{qѻ`KvK͠SDְ&^j=8jqCRӾnćٻ y'M! yMtJ{VbX {@ 8~׌b84+󁑠UFiF{)_$_=GFua>=/&#N^Y! }0i`52,`C; ǜuІT9v٭E1msĵ;qh8uS:z!lJ8)ikGɼГc8zR|EmH.۹/b{T'8A%{+x _ /G[9t] ]<{/qnY<_]ocvsk=`;noMUbЮ#H`WO:f.iNS2{xo,',ձW48fx$?!/}~ϯF1q3l_7=>w1Os~< ;ފv9[&JvfnU{lv3+rޞTCWjkrj3U%|5g.cnP'Vɰȇ8}r]{`aXε WCb}~bk,8d,@c?Q7LGVQC9OYvtuCjqu 5iT)|Þ+(^%?j13ӌ-df, z{GqJK&i'6cYGIr1r!DKTnjE/vu6#gF8`)*ځ1_9]}U/zW`M_ 4*pwB5^-UAؒQ=0mnO}w9(Pc_7a,Filfo }U,F!VM@'G`x4o3KM؝w ƵdȤ'\SfaMI8(%;\6 |R [DwҎenUuy2o;deS6cJGi.|= vp'y |p>k^:&4x<_L@K c6,ae#X&qo!T@{ZgUa4I: w٨ym?a_=/!բj Nyucl8ȓ؎tj0Wb%N^r_HڍsNm$]=K4 e/W~(|Zy^^'Y<$gd?aZ37^RLmf)u5* b /şB3:S;j^a<>~6;3c=2y @ H)334}i?mqs%5ܤW琪m<~W0<27H1s̹޸okr Lc%=u[R|TUhnrS^=">h{ЯA '-#1KV\}Ulj)/셦;/z` p&yq?3GQQoWcxf_DOaRO[-Uj<]͏K]b,T&/ya˧~SWW%}'@/3`UmCؐ]YXxT{z XkgV{NA-w3sKݷu|:@.whҡ}-#mD_m#sFNjAa="7GSTCmC:1sAMM\?e-z—W懥Kgs8{oCna*Xyo^pEeC,t5.Jw{ճ=k5U go;\+go(__B߭^jbϋK-qm\>|vy ;,[l)y_.U^yJS*!dp*wc#v#Ȉˣ`j c$'Jaub]̓SaE1ҫL0qk{Ձ.~Py2_MU\Bc9uG'߽[Џڰ,%ƴ]_o!oiqvCO^ USjN',3:Ӫe-aUUBGo2>Vُx\7{췅oun7[y })=ͮǦ]- W_~ca]M#Yiwvff`dBH-8[&fqb˒/$|RPKn>}.Z D~ZK~=5 ]8{Kurs8%J awrӸ7}a?N I`:z,pQkְgYn1)|}bNk`J,?c'c_7}W7ҷӵKbg{l񅓗|jyVzykZ3 ;-k}sIߑA[#)B ؃eW{4m\ ZgG}xa|Դ~B͇]]<ȁΠ-c37^q&X]9Q;o 3h;ov뗪{>A; :õtA}w^]^wpz{5WdOC| ~o+ܮ;M н >`ǜ>+LSp8SŅz`^% V°tgEq0j9. S+^`o˳J{*x%[d(nR-ajwۻo7Nf&^Nv&[Ðw0ؖgǸW2ɳIs$wlDlk27)-|ue%1 [[Yun/7;7&|zӰcz-C&pM xN'ge]h~.od+a.{{ ߭- 3eӝBtnƢ 4$l 5g9tw 5ٖ7U|(myo8_hyV<(`L9ћsrmw2 S~b SrV)2䍵!v }qNL5}prj5 :C 6Wni?sGVlܭ+~_Vw/5`oVYKO6gY0S]V?f<P&]0`Ϙep{ٵg_;̯4Qޮ)[g6kPKojwgF;еMdE) ? ٫TuF}yOU b*x7Mq/hdo$`}jܟ SkoIo㡗.OАR\z28WB3SkI'u{&'BW4m%cWC75ANGΙ?E2EϮ*-zV4㫕jW'E;»ŧ 6ih|Hރ8+/¢>NFiLF,5Urb:aDZWh4O8n~\R'a O'q(}?6,bcol1r=Essk 9IR<+# kEny=tLIq39n7r7<# u361y_9wB%e87"70rVd Qr?o}?6F/YIć1IdۓO ]U+>rK&Ǵ5ӣ!\fty# 3_C}jދ3Ȣ4G=  a/9}N? e܄^v5GS72)hA=1~?߭Ebcrhȋ߆7q&"GZi-Sy{0'>`ӆoH4 Q*Zz٧!k:w=C ƷAc2bv㷰n)ngf5e$M^$k=P5hw,`_㑗ID/@'#|50ge=6anSa떵x.׮&, ^qNOϚô\D  T"piilǶ TUg>䜪cw·*N#51S}}D9ǎKo{NK]'z.gW<x6?c.&8isǯc1qzR!<=sKfm' 4w?Ыq3*9i5dS&7#Ci-y2^8SM'99&#|S1>W{bYGɇxv{7]CL v6NĄđس98i"/1g'jA6٘ɜŜNaF樛)Of1eoCW M@thm^z.rX9wdG{xnU|ؙPMeög=9BL+8Ҳ͝~맷N5v_뚪n~-a*jjlbTcgC5_v g km37DgA "&O Sf-umГo]/_Rے_+'vm)bvwEw֡gGdf>I68S<޻.ڬ6ɱ> gҾEګW뾻n.f4xQ7}C}Q|'P1VvΥ!2A, 9+V 6UXt ϟ} ^jVsx2./%ϵrxO3\ŕkڹx) Ykn/Z,0Q%/aiOn==wp+|.w 2|\%7?od)4^_ C\(XmdU9ᷴQ 2DŽ hdpO}ªr:?y].XӅhs|0IMMՙ;Nv6tsd1"Fیu25h:BSz gIYi;}[sV/;|TAnU ~/QbOT KzC0/vv}>X%qp ]2g=͢XΆ,۫:>ѱԈ&392oo/εJ1x)BNǍVmSիI 1_y 3OSK=TU3Uȩ^x(.Y;qh;AT]'9B:An˘FF] 7!GPO<c2CC3 jį9f}vѷہzg^1 {#}a|\@Lϵ5qaa}#E^3azL÷`m'}F{Pz`oS{O8r;bx)GQ8„=2au~e u3݆M1-P_/3E_X1C헱\*pJp-G}gcE'PGC_>Qe?š/k/= w`}F=l 7iLYS\*M8^6 VY;€q8q, \RQ-o}8-uY}w|Q _-(8w=Gn}cUCWqPXWF}cFSUJ wV)2xyyrEzGUXw =s+׳GBTk_5=w1/Ց8?{)5h;&Iϋv#8Mt#a1ŷokHzDF}602u>174jyf^W5}~.@1˪W8ny'G}|Z U#[ܟ֛w]O1y/x︠ǯy>8>piq"LvQHWСy}pE\#ulzo/cG9~oNm/ 4.8s9y0nZ8kxLmN=~WJt{?cȧzϱщq5\&Z8-qM\/^}Rs`ܻ2_ga^arQ޻ljtNn;[ S8O2n&|Ivѷ{qd50VHR){d(07".Nc͞\=rP9%~1 3+& 9-,%_iܮ'q88mO?q^muM/vʇ\#wc໗1 Q-w*(̿dסdVzr 4L+4SϝF&8ٵ=6>Ε¾Q13k_pUf&hG ]{Jx0Mab}%-@gwt憎\1׻\A q22"kdBP7ےW`\pW=7wzvኹfrq,{Lcgܫ~[}Pe.yͳ~+Zb3kv9|zC©nE!"Wߞ[uU;Εy2셺\q, [TJfǯn|3}sJ?>AZm@=]-I?dfد1W u? o&״l s몜&2D'ROjjA}b Z  !^32nτgj5΃|~ed{~ [SS-VZK`JѤh@4t%5)Lʈk2ћG!2-34yKth$*')]>| C~~?%}9suAbAgS3qfpLAjUL@ Z=FdZ OcL{tLS+c[#c%k^>>O˳>p̩'W,j8j-' #fgڌͲn3iaWzhۊ@AoD$~ΚUgN%:&?Ԧ}jO K#?srG7;VqxY~|ⷪ{KncQe]]ٻwT?n(23U),6Vi[ zt50Lӥm-~_m^,9l V>VuYY^Dשfxی,BN Easm&u 'B.%6b{sd #ܢOu \ UȐ<@ F,} rAɫw: ߼nۺ>mk[/{C.}[ճ_7~}v[~e}~W#;yW53+RQoFd vL,oĺ] ƿFb٫}]'( cDgjVp1]oĂy% 3ט*Rhy"wrc:ZML&KVzh|! ަ-*QƵ'a2#S`Q[b&9K;nK @NZEm w_C&Cͳ#u)>fjq7PN ZfgDΌpHl6xtً|kf} .w>}xqaT9:~nt*IJ=I?ƹ&.m&H[wWy9#@XE~HJoGq/XlsUk°Soew=SbHG A`e5\oFztN׮kBwRzV4#=)nNRfxfVcU?FM{IR&.C?dUw؆wЩ:iw>n_A02aOu]T3.JfNWҫܺq3h&̷qzz}sgNs^ƑI*Tm%Y1-0d.HB@ln A2ҀH˲ uϐڟ{g?tiu>9㞅|N+<[ߢJkr0&QIq |0%ZA6b`Lӗ|yZ\э]̿isiv E:zFF?ug+:(*>/+sŽ>/䝟29w}zC=; kj{w#w8):=ᴳBjT&n{ܛOYo۠sOwnFY{v5dV  ,F7O aNY8;k7:9-uhz2vp&کZ{Qdv.y| ]SQ^{yp^\p H/;M<~%ϑ8F^:cǡqEK9x.c)QԢk6\d]K` E6cnVnF\[Z&(Se+k?)ؗ]2.Jθ/K_[|}'هw4<$ǡzepv?Y {atgA|^*3K'N=Ϙҩ%Ӌd'Y D!yywc"ɋKf\ϱWX6zJrl L}~9Onac-g#S+ؿ {.\/s]z ;eE_j/eo+犍64ka[71N qsڍGFX9Aѳ18 =[sO`^l]/NfgFvɵ2.?aQeL@{Dos`6(؀;,\ym=k5c{gh\?d1yb m ӲWSE S֨&&ޯ6RsЃSCOѣwKd}2;( 0gdwS *0fi U`&ezy8v:A #`0U#s81a sk22N%2hprTyz|\6{ɨ%j\F ;Ս>ڠ`So h0*K`@R5F5gr[NR> ;zZ QwZLX~,LɜZ`@[{&R卛.9.\ Ϻ֣u UZ[Y̩Zhk wR;~>d> OfN"5׊ CB\eNT)zɬWiv8x_ud~9Kc=쁦"cvNv˷+|˷/>w/?F.":g.~v-|tqwq􃟿~ù/f?O@>=DZXĺFӥPVOzdDsڍu1')U#4zՈMjşϵ dcbl0'7I5.[ 0'ky X߼u&<T&}MoPS ܕlvGz?McRj}93aD}o8UI* M>AxƻW 3ǚ]j:Ty'`옫Nő{:jb] dY5|}[ͨOq#<ʻzq/ovJ+Qյ[wuͻW3x<+†fd5ͭQo|yQ/}n3['$܇2ccǁ/pϭ˅ieFnsRf>Z;71>%Yq1xc)=3 ;ֳ_yވؐ?{G&;0~Dm 4|݇}ދ{ʤ jy׊>քX#hiUNotpGm6?9g;frkf|2 ^FgfU#@uKN0߈(4=)1z,焞\G== gA{uo n*:.Ӧ6+ *U8N7`lVY}i $0M$ZpԷ[o}Oɇ[{=sl;x~{wf먀#8`myW=yFSٌY02־jrɿ),*~jG7Off;wHVk' YM5 `ת&"f~Y*Fkg';`\{?Ͻ~=mP6a6^󰯓tX8B?̫ahY>iKɐ!`-׼:4kS`,4) ۥ< ay#Ef5 0C86> ָ!,5)+㑹.cyUS4[ E۲[/l5㓃v"<+KWm6;뱚;^Cș%M;m[ZewflW O~hLpa3w/qB=K;ic݈9ذIt#IO;hӨT'mLߛ@ߜ7{_nSr&&4ۗ3_ ҏ¨;!ɹݛk\| т=bڶm!Nȭ+f含=-- M@!DfcW5Sn?=&W2^ž ֕$nf& W?U2_'VisM[]ۤ-blGmlw-A `SCOLx&v=}ko:oC̷³<7Z`v, "󷜵Ħf|D8bJU3ѯzr^ub~ b\ug♽vlͰnUm1!c`Ol.MN# y%ПA,9EN;q{YX_|m)qKmkn#l=]/LvA5쥏FMd4BOp ,8)V{]D[7cJzѪvԳ3܎A=7_*q*&&rf,21(=2nAR2^O`f%-jW'.'<㈟'">?iX"_UDM ۙ)6g{mŲħϪn3D~4B3&5|)l ㍿[79x׮]c&Y Yp YCaN%}~c5~9Cr W/ F^oB7fuK;oUZL+:oU}U X;j~#<2_v8W+ 7Izh[+JgyOowhK"vO2Qۍ|5c {nn zyNj?>m\xyK0\ :x1`?Uuh Y !ۊ U'uhRQ~#;`Q,WF GxO_܀}!}[D$/l;i>,NSWG#V52 n_N|?y\*(oax(ԸpQ15mnxͪ^(nu?m\UzxU"#ຉ}DFu6m S<ݽ+_x-X?R֒ `b{D\lYG]n dpv uspiyvY,T̳ .4 !]Sȁku-۵5XmYK.*v}I&rC{%:F=H-A qc}0_pCLUcO3|uOΫ_>+_~Ypd,'-nwt/;,]_--]v?_2ȥI"`c9 0O`VK}J?I,rRynr_*X VKH̀8v_(otKJhLrS;=a{(|G'JNJ6}sJ9΢QL!VcO9(ƥOxH#5Z=6.2O0DW4*'0tՎo~LwܮQHSy~|fqbS(%' m g_Ovr Ğ%Zzl #c`m_>-ynʁrD6N=zlA ֟ɾֱFW-lpEџ8ֆZlshJϫ?4;ճ7൷GfUk/{\U+5Zٸ2`A/5-ͽ,ڮO0c+aͲF(o45ͧxΦ_˴ /UJM&<,ocfj풵K600I2FkKmIש+OVZw9syEhBD`2⚏ȩ FK^Ȅ` qkNpȎR4gbX ?opŴ}ZJ— >$N-6zi. 0%}ؔr!ˆ 9˒8Rs߬$8!X#F &z݌Eb{a}s߆+,?lKp@n?i求_L aפf}'B{16 ?OWNܰ>4a|$"NCurrO"c \Zۆ=p aߨ5`BV):Yohbg~ۥ-9o9y2?%6uQ h?5~/c<|Hlzd-Q̢%fj!>U72={N/T;_d9 <_W%I)΁3 9:kV^-"wp}N~:$S<'.CP]yz]r& nS!^ OFQC_kf#w.XUni}^BlB'SGs빐_f1=*zZJ,+ڽVxL=@Cpmی9V!qɁqEdq)|7О->mJ,΁>)Zk6u<%hu#D$5Xo03/hmqQ,vj\w:6>[Nz}]g&Wk?bj"7!SǑ️N3>:mBcԻԯ^'FBKSҬ5*ucovnhV}jN3p]}]qȺX+GNe3Nbuh%+sN#Gn 066ی=4VtѭnlO 9{fl tich|ppg=, nOfWΏ14[Ŧ1ZǾK36c`4+kÂE.(]tl7铪n{Ȋ |g߷`ֿUU ^ϗDQ5?1xK5cEܯqEbXǾv-8f]bvaVxmd>Ub_jsY͘QCnv 4 CeqCerayZ\Z.b53˜2Nog60SM98ly\_}IOF~"^KN/Vġjk#7=+<3&=cjФ #?f \S-pQU߽ƽc d^[TMlp[9T ntڸO"ǟUlnu:I=ܪj6Yy4I_|F5cdMI{`3mB昻w5`u]\"Y,[>:@̟VϧZy\GWͼsKiVxy|[uuڹu'ҷ]ƀeƵ#8߽o?o}Wt/<{ۑ}Zyrk,(h G<MfM{c-NbKn^\t'0ѱntx?pN>}t{߃2^s{%?WɴR{Gr## -C͕|oUF"v%Düaml&S0IPQ'1(g[] 5d^00K \M 9P8Ÿ3(>`2:^~J z%֬wrPw2\v 8lLƵ׺e֥9ms,xp>/.A0~\YaqB|ˌcREvAD42wE-Ktv5qͱߌӶ=Њ삡UpaBU* Y AYTi= ٫͜c+I*?bϋ{Uu}{X;D[q' ƲY1KR +@چjH {~%/" &*h mprp{ϵŇho[^"Fd_^^j~_-\rŸ}'Ni-KW؈] —a|6iW{4œ1#vjyO<4Ԟ:eV+"OޛvE/>f)W|W Ji5(p,#a.t?b,&k~w=16ilf?ǀe#_.r좜H𮅼وęrЫY ~XHkf&Џ30l.xAvT#aSGa+bUn4OqY "rL5JXx!YEح8yBάةT;$j 14OCfpT#?>c)$:QnbtRuD._nǜ!:'~)`2W{!փm0G:Rͥ9 :gQufjʼn)FMƴ5Oy?=}ơ<~z5|?5V߭8z1R-r=Ib|`,(]<2,b@Agf~;{,EgGXY e7 g2y?Ȅ F.!=ߗ3f;+o^?{%{ݰsq@EP^$T SpWo1Qp's_u֋bMybWo̥̎!pe#^ ⾠k.}8L0^B?f(/{VMetx14 (p(Yi̅ć[Sƒl'XYqA>KHl; 7ґf!@^g.z}O>C{NtYϲӘw8=u ~ $r@D.|oo)Gke92#JIQ]fg޵'^{;3uk?OXp_F]ҡd;0 d伟pНbK(Ϗ"4^سGρ4v1 lսfuʳ]Wh_i1I-sYCVv\Raݝ}fKZ&ۈjrCGxC\_@+a.uf=s??lKY< HĭZ_+=->! O nT?MlU@5:L 1ו>f |+j@y\OMdijZ[S0 rYTf70$!tHqkkg&NM'ktw9?J >?aA7rϷp`X, ' =ܗ9lVw[ , CqϑTKU]P1 ߡ݊q{Z2G~)VOx.Frd4. G/#IuHcT}DTXأBA^Y|pͽ_;ߔ*gW jhODkwBدKX=s3ꔽUݏ1f9L\]mR=bEyk쉊-8Gq F֧ϣ3pBj`O=R+O§(tZAU~iG,o6l6J/v嵊=U14U >)iDD+_x?zbi 4-S^ugUrOÜ$ȯ:9W`3zFC,+:B߹f%IuZ'R粱8ui%3_QsR{f榤Ùj!D'(9y5 Wn5+ƌi9Β.F1xZIcL/Q:6s9rH{[!CnOaƦywς \[J+@d] f,EkkthCa:XWJG(m L(?.S?Sj܃{Ag!3K4]ONrC|>'3v31yHޤf:X{}.kВCe[d.{zyC>Z9ѣ5&#MQ {Ω\쀽aMJzh1mN~s<8 _O  FAb7]:X_m]_e-HN{#Y۵5jkg\}REFH.odC[B#a=۝/KO;~o>c$8ig}i/Y;[ ,g7X9YUnj͸؂b/2rx~<惞]wEJ}L RϚqKl3+䦁~RN3~[ila-&4k#>i׶G -xFnMHe.Z|ѿ?ND[ ⴲĤ{},ROߖ ;#m=:.Dc:|\}Q.q,rpTi ~sܢ̸s䡨E_FxԮ_ֶ}9͌}?|H|˚zfNݹ@>``.)F!PY̌of1N{O )>ߤ\+6f_)>"f b=1\dLj9.;M ԧۉϢmK3`n%o ur$y`e*Vd'ȷ(yx(zat잧]38VH>ĒkP,9.Va?5 ^r< _cϿm+v=Ϸ S:z&aQٯWp#f &z>} 55Cƕm$=Ga.u?Dڜ{ς5o=CׯCY픺;/*9)'^?`O(0s/&"/~eK#Mj5؊0M#=ul~M8}՟UW{q8\[5ഋCv}$M{=AM""F) tm VdܥL|wyt%rzDEn A`.b.g?jV}쥆5u50wW҂iVCqq^(?soߺֻ_]wG7ngb^hEcowNvX|Ve@:>o⛏8(:ɣNUUOxn;_x&[K]hY. , &;d~yG~2E>.x\Bm-|>C*[Lx`:,Mgp;0E6w4rOlLK^w/;,qN }*ΚɾŠ;Bi%3Ep>x+B6t{7n)wy^IWRϥB{q%i.6, yq0`x`ll2ؘMHB.ACnKFKT*eGM2礘*2.yBuWJY"Fr XHivp٘#2WsN? zFD{/\ȡ𝄞ampms7 AVb\Plʹwm.l+1^{y?Z̲!_?I='0Bν3tٸ,E<7 8fz1s^b>5v!ȇȍr |OoQkU!/|VT8FaO^m3ɥ`3)8n{08\ͯNnWG|}I_=Uu f/p7`w<ڝy.۟u)bn";*בr9kTC[az"KKO 0,}:=`VqU3UOW;Gk)xdW12A *ZfQUɪzƅ77Xr{/YO{up+ ,mZ--F!QM {=u`ҦuWi[vo